circular non-coding RNA circSTK39 and application thereof in prevention and treatment of atherosclerosis
An atherosclerotic, non-coding technology, applied in the field of molecular biology, can solve the problem of unclear function of circRNA
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1: Construction of a silencing model of smooth muscle cell circSTK39
[0030] 1. Materials
[0031] 1.1 Cells and siRNA
[0032] The mouse aortic smooth muscle cells (MVSMC) used in the present invention are derived from the aorta of C57BL / 6 mice, extracted and cultivated by the tissue adherent method, and the cell culture application contains 10% inactivated fetal bovine serum (Science Cell, USA) , penicillin (100 U / mL), and streptomycin (100 μg / mL) in DMEM medium, and the culture conditions were 37° C., 5% CO 2 . Human aortic smooth muscle cells (HASMC) were purchased from ATCC cell bank in the United States, and the Vascular Smooth MuscleCell Growth Kit was used for cell culture.
[0033] Design mouse circSTK39 silencing (siRNA) sequence:
[0034] RNAi-1 sense strand (Sence): UCCGCUGCCUUCUUGGCUCTT,
[0035] RNAi-1 antisense strand (Antisense): GAGCCAAGAAGGCAGCGGATT,
[0036] RNAi-2 sense strand (Sence): UGCUCCGCUGCCUUCUUGGTT,
[0037] RNAi-2 antisense s...
Embodiment 2
[0046] Example 2: Regulatory effect of circRNA on mouse aortic smooth muscle cell proliferation and migration
[0047] 1. Materials
[0048] 1.1 cells
[0049] The cells used in the experiment and the culture method were the same as in Example 1.
[0050] 1.2 Reagents
[0051] Design mouse circSTK39 silencing (siRNA) sequence:
[0052] si-circSTK39-1 sense strand (Sence): UCCGCUGCCUUCUUGGCUCTT,
[0053] si-circSTK39-1 antisense strand (Antisense): GAGCCAAGAAGGCAGCGGATT,
[0054] si-circSTK39-2 sense strand (Sence): UGCUCCGCUGCCUUCUUGGTT,
[0055] si-circSTK39-2 antisense strand (Antisense): CCAAGAAGGCAGCGGAGCATT.
[0056] CCK-8 was purchased from Tongren Chemical Technology Co., Ltd., Japan, and EDU staining kit was purchased from Guangzhou Ruibo Biotechnology Co., Ltd. Crystal violet staining solution was purchased from China Biyuntian Biotechnology Company. 4% paraformaldehyde, 0.5% Triton X-100 penetrant, 2mg / mL glycine solution and other reagents were prepared by o...
Embodiment 3
[0071] Example 3: Regulatory effect of circRNA on the proliferation and migration of human aortic smooth muscle cells
[0072] 1. Materials
[0073] 1.1 cells
[0074] The cells used in the experiment and the culture method were the same as in Example 1.
[0075] 1.2 Reagents
[0076] Design human circSTK39 silencing sequence:
[0077] si-circSTK39 sense strand (Sence): CAAAAAGGCAGUGGAGCUATT,
[0078] si-circSTK39 antisense strand (Antisense): UAGCUCCACUGCCUUUUUGTT.
[0079] All the other reagents are the same as in Example 2.
[0080] 2. Method
[0081] 2.1 CCK8 proliferation assay
[0082] With embodiment 2.
[0083] 2.2 EDU experiment
[0084] With embodiment 2.
[0085] 2.3 Transwell experiment
[0086] With embodiment 2.
[0087] 2.4 Cell scratch experiment
[0088] With embodiment 2.
[0089] 3. Results
[0090] 3.1 Effect of circSTK39 on the proliferation ability of human aortic smooth muscle cells
[0091] In order to verify whether circSTK39 affects th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


