circular non-coding RNA circSTK39 and application thereof in prevention and treatment of atherosclerosis

An atherosclerotic, non-coding technology, applied in the field of molecular biology, can solve the problem of unclear function of circRNA

An atherosclerotic, non-coding technology, applied in the field of molecular biology, can solve the problem of unclear function of circRNA

CN114032237APending Publication Date: 2022-02-11HARBIN MEDICAL UNIVERSITY

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • circular non-coding RNA circSTK39 and application thereof in prevention and treatment of atherosclerosis
  • circular non-coding RNA circSTK39 and application thereof in prevention and treatment of atherosclerosis
  • circular non-coding RNA circSTK39 and application thereof in prevention and treatment of atherosclerosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Construction of a silencing model of smooth muscle cell circSTK39

[0030] 1. Materials

[0031] 1.1 Cells and siRNA

[0032] The mouse aortic smooth muscle cells (MVSMC) used in the present invention are derived from the aorta of C57BL / 6 mice, extracted and cultivated by the tissue adherent method, and the cell culture application contains 10% inactivated fetal bovine serum (Science Cell, USA) , penicillin (100 U / mL), and streptomycin (100 μg / mL) in DMEM medium, and the culture conditions were 37° C., 5% CO 2 . Human aortic smooth muscle cells (HASMC) were purchased from ATCC cell bank in the United States, and the Vascular Smooth MuscleCell Growth Kit was used for cell culture.

[0033] Design mouse circSTK39 silencing (siRNA) sequence:

[0034] RNAi-1 sense strand (Sence): UCCGCUGCCUUCUUGGCUCTT,

[0035] RNAi-1 antisense strand (Antisense): GAGCCAAGAAGGCAGCGGATT,

[0036] RNAi-2 sense strand (Sence): UGCUCCGCUGCCUUCUUGGTT,

[0037] RNAi-2 antisense s...

Embodiment 2

[0046] Example 2: Regulatory effect of circRNA on mouse aortic smooth muscle cell proliferation and migration

[0047] 1. Materials

[0048] 1.1 cells

[0049] The cells used in the experiment and the culture method were the same as in Example 1.

[0050] 1.2 Reagents

[0051] Design mouse circSTK39 silencing (siRNA) sequence:

[0052] si-circSTK39-1 sense strand (Sence): UCCGCUGCCUUCUUGGCUCTT,

[0053] si-circSTK39-1 antisense strand (Antisense): GAGCCAAGAAGGCAGCGGATT,

[0054] si-circSTK39-2 sense strand (Sence): UGCUCCGCUGCCUUCUUGGTT,

[0055] si-circSTK39-2 antisense strand (Antisense): CCAAGAAGGCAGCGGAGCATT.

[0056] CCK-8 was purchased from Tongren Chemical Technology Co., Ltd., Japan, and EDU staining kit was purchased from Guangzhou Ruibo Biotechnology Co., Ltd. Crystal violet staining solution was purchased from China Biyuntian Biotechnology Company. 4% paraformaldehyde, 0.5% Triton X-100 penetrant, 2mg / mL glycine solution and other reagents were prepared by o...

Embodiment 3

[0071] Example 3: Regulatory effect of circRNA on the proliferation and migration of human aortic smooth muscle cells

[0072] 1. Materials

[0073] 1.1 cells

[0074] The cells used in the experiment and the culture method were the same as in Example 1.

[0075] 1.2 Reagents

[0076] Design human circSTK39 silencing sequence:

[0077] si-circSTK39 sense strand (Sence): CAAAAAGGCAGUGGAGCUATT,

[0078] si-circSTK39 antisense strand (Antisense): UAGCUCCACUGCCUUUUUGTT.

[0079] All the other reagents are the same as in Example 2.

[0080] 2. Method

[0081] 2.1 CCK8 proliferation assay

[0082] With embodiment 2.

[0083] 2.2 EDU experiment

[0084] With embodiment 2.

[0085] 2.3 Transwell experiment

[0086] With embodiment 2.

[0087] 2.4 Cell scratch experiment

[0088] With embodiment 2.

[0089] 3. Results

[0090] 3.1 Effect of circSTK39 on the proliferation ability of human aortic smooth muscle cells

[0091] In order to verify whether circSTK39 affects th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a circular non-coding RNA circSTK39 and an application of the circular non-coding RNA circSTK39 in prevention and treatment of atherosclerosis. According to the present invention, complete transcriptome high-throughput sequencing is performed on the artery tissue in a mouse AS model, and the circular non-coding RNA-circSTK39 with characteristics of expression in the advanced AS group and high conservative property is screened, wherein the circSTK39 in human is obtained after a DNA (deoxyribonucleic acid) sequence as shown in SEQ ID NO. 1 is transcribed. The invention finds that circSTK39 plays an important role in the whole occurrence and development process of atherosclerosis by exploring the regulation and control function of circSTK39 on proliferation and migration of vascular smooth muscle cells. According to the present invention, a target spot can be screened clinically, such that the early atherosclerosis can be subjected to drug intervention in time so as to delay or even reverse the disease. In the screening of the advanced atherosclerosis, the lesion development condition of a patient can be known, and clinical events can be timely intervened and avoided. Therefore, the invention provides a novel molecular marker and an intervention target for preventing and treating atherosclerosis.

Description

technical field [0001] The present invention relates to a circular non-coding RNA-circSTK39 and its application in preventing and treating atherosclerosis. The invention belongs to the field of molecular biology, Background technique [0002] With the development of society and economy, the morbidity and mortality of cardiovascular diseases are increasing worldwide. The report on cardiovascular health and diseases in China pointed out that in 2018, the death of cardiovascular diseases accounted for the first cause of death among urban and rural residents in my country, and the rural areas 46.66% in urban areas and 43.81% in urban areas. Cardiovascular disease has become one of the important diseases threatening public health. Atherosclerosis (AS) is considered to be a chronic inflammatory response caused by the interaction of multiple factors, and is the main pathological basis of various cardiovascular and cerebrovascular diseases. In the early stage of AS, it often shows ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
11 Feb 2022
Publication
CN114032237A
IPC
C12N15/113; C12N15/864; A61K31/7105; A61P9/10
CPC
C12N15/113; C12N15/86; A61P9/10; C12N2310/532; C12N2750/14143; C12N2800/107; C12N2320/32
Inventors
田进伟; 于波