Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

MiRNA simulant and application thereof

A technology of mimics and drugs, applied in the field of miRNA mimics, can solve the problems such as the application of miRNA24-3p mimics as corneal epithelial wound healing drugs, to achieve high commercialization potential and transformation application prospects, accelerate epithelial wound healing, The effect of accelerating corneal re-epithelialization

Pending Publication Date: 2022-03-01
SOUTH CHINA UNIV OF TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no application of miRNA24-3p mimics in the preparation of drugs to promote corneal epithelial wound healing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MiRNA simulant and application thereof
  • MiRNA simulant and application thereof
  • MiRNA simulant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] (1) Adipose-derived mesenchymal stem cells derived from inguinal subcutaneous adipose tissue of New Zealand white rabbits (purchased from Guangdong Provincial Medical Experimental Animal Center) were selected for isolation, culture and passage

[0031] a) The New Zealand white rabbits were killed by euthanasia, and the subcutaneous adipose tissue of the inguinal part of the rabbits was taken under aseptic conditions, and the PBS buffer (pH7.4, In Gibco company, the same below;) repeated washing 3 times;

[0032] b) Use ophthalmic scissors and ophthalmic forceps to remove fascia and blood vessels, rinse with pre-cooled PBS buffer 3 times, take the fat globules and gently transfer them to a sterile plate, and then add 2 times the volume to dissolve them in PBS buffer 1% collagenase type II (purchased from SIGMA, USA) solution in the solution, and placed in a 37°C incubator, and the plate was taken out every 10min and gently shaken, and the total digestion time was 120min;...

Embodiment 2

[0040] The extracted exosomes derived from adipose-derived mesenchymal stem cells, rabbit corneal epithelial cells and rabbit adipose-derived mesenchymal stem cells were subjected to next-generation sequencing (sequencing was completed by Guangzhou Huayinkang Medical Group Co., Ltd.). Then, the data was analyzed and screened based on the principle of the expression of the selected miRNA and the high expression of adipose-derived mesenchymal stem cells, and finally one miRNA was screened and a double-stranded miRNA mimic (ie: miRNA24-3p mimic) was synthesized for functional experiments; ,

[0041]The nucleotide sequence of the miRNA 24-3p mimic is: TGGCTCAGTTCAGCAGGAACAG (SEQ ID NO: 1);

[0042] miRNA 24-3p mimics:

[0043] Forward primer: UGGCUCAGUUCAGCAGGAACAG (SEQ ID NO: 2);

[0044] Reverse primer: CUGUUCCUGCUGAACUGAGCCA (SEQ ID NO: 3).

Embodiment 3

[0046] Follow Lipofectamine TM RNAiMAX transfection reagent (purchased from Invitrogen Company) instruction manual transfected rabbit corneal epithelial cells, namely: ① inoculation of 0.25-1 × 10 6 Put rabbit corneal epithelial cells (purchased from Beina Biotechnology) into 6-well plates and incubate for 4 hours; ②Take 9 μL of Lipofectamine TM Add RNAiMAX Transfection Reagent to 150 μl Culture medium (purchased from Thermo Fisher Scientific (China) Co., Ltd.) was mixed evenly to obtain mixed solution 1; Mix well in the culture medium to obtain mixed solution 2; ④ fully mix the mixed solution 1 obtained in step ② and the mixed solution 2 obtained in step ③ according to the ratio of 1:1 by volume, and incubate at room temperature for 5 minutes to obtain mixed solution 2. Solution 3; ⑤ Take 250 μL of the mixed solution 3 in step ④ and add it to the 6-well plate in step ①, then add 1 mL of complete medium in an incubator with 5% CO 2 Incubate at 37° C. for 1-3 days to obt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a miRNA simulant and application thereof, and belongs to the technical field of regenerative medicine. The miRNA simulant is a miRNA 24-3p simulant, and the nucleotide sequence of the miRNA simulant is as shown in SEQ ID NO: 1. The miRNA simulant promotes corneal epithelial cell migration by up-regulating expression of cell migration related genes (CDC42, FRS2, CTGF, EGFR and MMP9), further accelerates healing of epithelial wounds, is a good medicine suitable for corneal epithelial defect repair, and provides a new direction for clinical medicine transformation.

Description

technical field [0001] The invention belongs to the technical field of regenerative medicine, and in particular relates to a miRNA mimic and application thereof. Background technique [0002] The corneal epithelium is located at the front of the eyeball and is directly exposed to the external environment. Eye trauma, bacterial or viral infection can cause corneal epithelial defects, which can lead to vision loss and even corneal clouding. Therefore, the corneal epithelium is the tissue we need to focus on protecting. Under normal circumstances, corneal epithelial defects can heal within 7-14 days after the incubation period, lag period, migration period, proliferation period and re-epithelialization period. If it is damaged, it will be difficult to heal and recurrent epithelial defects, and even cause corneal scarring, affecting normal vision. This is mainly due to the secretion of inflammatory factors and activation factors by surrounding epithelial cells, resulting in fi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/11A61K31/7088A61K35/28A61P17/02A61P27/02
CPCC12N15/113A61K31/7088A61K35/28A61P17/02A61P27/02C12N2310/141A61K2300/00
Inventor 任力孙晓敏宋文婧
Owner SOUTH CHINA UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com