Molecular marker closely linked with major QTL (quantitative trait loci) of lateral root number in wheat seedling stage as well as detection primer and application of molecular marker

A molecular marker, number-based technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problem that the number of lateral root molecular markers cannot be effectively used in molecular-assisted breeding, and the linkage markers are far from the target gene. and other problems, to achieve the effect of promoting transfer application, fast and efficient detection, and stable amplification

Pending Publication Date: 2022-03-01
QINGDAO AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the large QTL interval of these wheat lateral root numbers, the linkage markers are far away from the target gene, so molecular markers of lateral root number cannot be effectively used in molecular assisted breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker closely linked with major QTL (quantitative trait loci) of lateral root number in wheat seedling stage as well as detection primer and application of molecular marker
  • Molecular marker closely linked with major QTL (quantitative trait loci) of lateral root number in wheat seedling stage as well as detection primer and application of molecular marker
  • Molecular marker closely linked with major QTL (quantitative trait loci) of lateral root number in wheat seedling stage as well as detection primer and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1. Molecular markers closely linked to the major QTL for the number of lateral roots in wheat seedling stage

[0037]Using common wheat TAA10 and synthetic hexaploid wheat XX329 as parents, 182 RIL families were derived as test materials. Using QTL mapping analysis, the main QTL for the number of lateral roots (QLrn5D) was located on chromosome 5D. Using TAA10 and XX329 Based on the resequencing data, an InDel molecular marker QAU5D-20 with polymorphism among the parents was designed and developed near the LOD prediction peak of the QLrn5D segment. The sequence of the upstream primer of the molecular marker QAU5D-20 is: TTGATAAAAAGCCCCCTTCC (SEQ ID NO: 2), and the sequence of the downstream primer is: GCTAATTAGACCCGGCAACA (SEQ ID NO: 3).

[0038] Using the genomic DNA of wheat variety TAA10 as a template, the upstream primer shown in SEQ ID NO:2 and the downstream primer shown in SEQ ID NO:3 were used for PCR amplification.

[0039] The PCR amplification reacti...

Embodiment 2

[0049] Example 2, Acquisition of Molecular Marker QAU5D-20

[0050] The method for obtaining the molecular marker QAU5D-20 specifically includes the following steps:

[0051] Step 1: Form the F8 generation RIL population of 182 families

[0052] Hybrid F was obtained by crossing TAA10 and XX329 as parents 1 , hybrid F 1 Selfing produces F2,

[0053] f 2 The F8 generation RIL population containing 182 families was formed by selfing generation by generation;

[0054] Step 2: extracting leaf DNA of wheat RIL population with CTAB method, specific methods and procedures are as follows:

[0055] (1) Take 0.2 g of young leaves of wheat plants, put them in a 1.5 ml Eppendorf tube, add liquid nitrogen, and grind them into fine powder.

[0056] (2) Add 600 μl of 1×CTAB extraction buffer preheated at 65°C to the centrifuge tube, and shake gently to mix.

[0057] (3) Incubate in a 65°C water bath for 60 minutes and shake the centrifuge tube carefully every 10 minutes.

[0058] (4)...

Embodiment 3

[0092] Embodiment 3, the application of molecular marker QAU5D-20

[0093] Based on previous tests and analysis, it can be seen that: (1) the primer pair consisting of the upstream primer shown in SEQ ID NO: 2 and the downstream primer shown in SEQ ID NO: 3 can be used in identification or auxiliary identification of the number of lateral roots in wheat seedling stage Among traits, it can also be used to obtain molecular markers related to the number of lateral roots in wheat seedling stage; (2) Molecular marker QAU5D-20 can be used in identifying or assisting in identifying the number of lateral roots in wheat seedling stage, and can also be used in breeding Lateral root number genotypes in wheat.

[0094] In summary, the primer pair and molecular marker QAU5D-20 provided by the present invention can greatly accelerate the molecular marker-assisted breeding process of wheat lateral root number, and have important application value for genetic improvement of wheat root system ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a molecular marker closely linked with a main effect QTL (Quantitative Trait Loci) of the number of lateral roots in a wheat seedling stage as well as a detection primer and application of the molecular marker. The nucleotide of the molecular marker is a sequence as shown in SEQ ID NO: 1 in a sequence table; the nucleotide of the detection primer is the sequence as shown in SEQ ID NO: 2 and SEQ ID NO: 3. The invention also comprises a method for assisting in identifying the lateral root number character in the wheat seedling stage, which comprises the following steps: designing a primer according to the nucleotide sequence of the molecular marker, carrying out amplification by taking the detected wheat genome DNA as a template, and judging whether the molecular marker exists in an amplification product or not. The method can be used for detecting whether a wheat variety (line) contains the QTL site for increasing the number of lateral roots or not, and can be used for breeding and breeding of excellent root architecture of wheat.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a molecular marker closely linked to the main effect QTL of the number of lateral roots in wheat seedling stage, its detection primer and its application in crop seed selection and cultivation. Background technique [0002] Wheat is an important cereal crop and the main food source, which plays an important role in my country's food security. As an important organ of wheat to absorb water and nutrients, the root system plays an important role in the growth and development of the aboveground part and the formation of yield. The root system of wheat belongs to the fibrous root system, which is the general term for the lateral roots and root hairs produced on all primary roots, secondary roots and their branches of wheat. Like most agronomic traits, root-related traits are typical quantitative traits that are regulated by multiple genes. The isolation and identification of genes face g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/13C12Q2600/156C12Q2531/113C12Q2565/125
Inventor张玉梅王会芳刘义国孙新灵付晓凤李夕梅郭卫卫
OwnerQINGDAO AGRI UNIV