Specific primer and probe combination for qPCR (quantitative polymerase chain reaction) quantitative detection of copy number of target gene of urothelial carcinoma and application of specific primer and probe combination

A technology for urothelial cancer and quantitative detection, which is applied in the determination/inspection of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc., and can solve the problems of complicated operation, long detection time, and poor specificity of detection methods.

Active Publication Date: 2022-03-25
THE THIRD XIANGYA HOSPITAL OF CENT SOUTH UNIV +1
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Patent CN201910044288.5 discloses that the expression of YTHDF2 gene can be used as a marker for the diagnosis of urothelial carcinoma, patent CN201810926958.1 discloses that the copy number of FRS2 gene will increase in bladder cancer, and patent CN201410212369.9 discloses the copy number of DHFR gene The number can be used as a marker for bladder cancer detection, but these studies only studied the differences in the expression of these genes in bladder cancer tissues and normal tissues, and did not further study the specificity of these genes. We know that a cancer The occurrence of the disease will be accompanied by abnormal expression of many genes, and the abnormal expression of a gene may be related to many cancers. It may be a pan-oncogene, and its abnormal expression cannot be determined to be caused by a certain type of cancer. Abnormal expression is generally expressed abnormally in multiple cancer types
[0007] In summary, the existing detection methods generally have problems such as complicated operation, long detection time, high detection cost, special analysts and special detection equipment, and poor specificity of some relatively simple detection methods.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer and probe combination for qPCR (quantitative polymerase chain reaction) quantitative detection of copy number of target gene of urothelial carcinoma and application of specific primer and probe combination
  • Specific primer and probe combination for qPCR (quantitative polymerase chain reaction) quantitative detection of copy number of target gene of urothelial carcinoma and application of specific primer and probe combination
  • Specific primer and probe combination for qPCR (quantitative polymerase chain reaction) quantitative detection of copy number of target gene of urothelial carcinoma and application of specific primer and probe combination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Assess primer amplification efficiency for target genes and internal reference genes

[0062] The specific primers and probe sequences of CDKN2A gene are shown in Table 1:

[0063] Table 1

[0064] name sequence(5'->3') serial number forward primer TCCCAGTCTGCAGTTAAGGG SEQ ID NO.1 reverse primer GGAGGGTCACCAAGAACCTG SEQ ID NO.2 detection probe CCTCTGGTGCCAAAGGGCGG SEQ ID NO.3

[0065] The specific primers and probe sequences of NUMA1 gene are shown in Table 2:

[0066] Table 2

[0067] name sequence(5'->3') serial number forward primer AAGACTGAAATCCTAACAGGGCAG SEQ ID NO.4 reverse primer CAGGTCAACGGGGTGAGTCAG SEQ ID NO.5 detection probe GTGTGGGTGTGGCTTGGCAGT SEQ ID NO.6

[0068] The specific primers and probe sequences of FOSL2 gene are shown in Table 3:

[0069] table 3

[0070] name sequence(5'->3') serial number forward primer CCTGGAGGGAAGTCAGACCG SEQ ...

Embodiment 2

[0093] Detection of gene copy number

[0094] The CDKN2A gene reaction solution was prepared, wherein the CDKN2A gene forward and reverse primer concentrations were 20 μM, the probe concentration was 5 μM, and the forward and reverse primer concentrations of the internal reference genes CFTR1 gene and POP1 gene were both 5 μM;

[0095] Prepare a NUMA1 gene reaction solution, wherein the concentration of the forward and reverse primers of the NUMA1 gene is 20 μM, the concentration of the probe is 5 μM, and the concentrations of the forward and reverse primers of the internal reference genes CFTR1 gene and POP1 gene are both 5 μM;

[0096] Prepare a FOSL2 gene reaction solution, wherein the concentration of the forward and reverse primers of the FOSL2 gene is 20 μM, the concentration of the probe is 5 μM, and the concentrations of the forward and reverse primers of the internal reference genes CFTR1 gene and POP1 gene are both 5 μM;

[0097] Prepare the BECN1 gene reaction solut...

Embodiment 3

[0117] Establishment of predictive model for auxiliary diagnosis of urothelial carcinoma

[0118] Collect 50 urothelial carcinoma-positive and 30 urothelial-carcinoma-negative samples respectively. All samples come from hospitals, and the judgment of positive and negative is based on clinical diagnosis. Take 30mL urine sample to separate urine precipitate and extract DNA.

[0119] The CDKN2A gene reaction solution was prepared, wherein the CDKN2A gene forward and reverse primer concentrations were 20 μM, the probe concentration was 5 μM, and the forward and reverse primer concentrations of the internal reference genes CFTR1 gene and POP1 gene were both 5 μM;

[0120] Prepare a NUMA1 gene reaction solution, wherein the concentration of the forward and reverse primers of the NUMA1 gene is 20 μM, the concentration of the probe is 5 μM, and the concentrations of the forward and reverse primers of the internal reference genes CFTR1 gene and POP1 gene are both 5 μM;

[0121] Prepar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific primer and probe combination for qPCR (quantitative polymerase chain reaction) quantitative detection of copy number of target genes of urothelial carcinoma and application of the specific primer and probe combination. The method comprises the following steps: detecting amplification Ct values of four genes, namely CDKN2A, NUMA1, FOSL2 and BECN1, related to urothelial carcinoma in urine precipitation DNA (Deoxyribose Nucleic Acid) by utilizing a multiple real-time fluorescent quantitative PCR (Polymerase Chain Reaction) method, and respectively calculating copy numbers of the four genes by taking two genes, namely CFTR1 and POP1 as internal references and adopting a 2-delta delta Ct method (Livak method). And a prediction model for auxiliary diagnosis of the urothelium carcinoma is established by using the urine sediment DNA of 50 urothelium carcinoma patients and 30 normal persons.

Description

technical field [0001] The invention relates to specific primers, probe combinations and applications for quantitative detection of urothelial cancer target gene copy number qPCR. The invention belongs to the technical field of gene detection. Background technique [0002] Urothelial carcinoma is a multi-source malignant tumor originating from the urothelium, including renal pelvis cancer, ureter cancer, bladder cancer, and urethral cancer. These cancers that occur in the urothelium are often highly malignant. It is a fatal cancer and one of the common malignant tumors. qPCR method is used to detect nucleic acid in urine and urothelial cancer-related targets, common detection of urothelial cancer-related mutated genes, methylated gene targets, and combined detection of mutated genes and methylated targets, etc. Currently, relatively quantitative qPCR methods are rarely used to detect copy number variations of genes associated with urothelial carcinoma. [0003] At present...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6886C12Q1/686C12N15/11
CPCC12Q1/6886C12Q1/686C12Q2600/158C12Q2600/166C12Q2561/113C12Q2563/107C12Q2545/114C12Q2537/143
Inventor王龙鞠巍刘建业李超徐根明汤维姚鲲李永祥李仁君
OwnerTHE THIRD XIANGYA HOSPITAL OF CENT SOUTH UNIV