Application of soybean histone demethylase GmJMJ30-2 in regulation and control of stress tolerance of plants
A technology of plant stress tolerance and stress tolerance, applied in the biological field, can solve the problem of relatively few protein function studies.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Example 1. Obtaining and Stress Tolerance Identification of GmJMJ30-2 Transgenic Soybean Hairy Roots
[0063] 1. Obtaining hairy roots of transgenic GmJMJ30-2 soybean
[0064] 1. The cDNA clone of soybean histone demethylase GmJMJ30-2 coding gene GmJMJ30-2
[0065] 1) The stress-tolerant soybean variety Nannong 1138-2 was cultured under light, and after two weeks of growth, the seedlings were taken to extract RNA respectively. The specific extraction method is as follows: Grind 1 g of fresh seedlings in liquid nitrogen, suspend in 4mol / L guanidine sulfide, extract the mixture with acid phenol and chloroform, add absolute ethanol to the supernatant to precipitate total RNA, and then dissolve in water , to obtain total RNA.
[0066] 2) Synthesize cDNA by reverse transcription with reverse transcriptase.
[0067] 3) Using the cDNA obtained by reverse transcription as a template, PCR amplification was performed using primers JMJ30-2L: ATGTCGACCACAACTGTATC and primer JMJ3...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


