Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of soybean histone demethylase GmJMJ30-2 in regulation and control of stress tolerance of plants

A technology of plant stress tolerance and stress tolerance, applied in the biological field, can solve the problem of relatively few protein function studies.

Pending Publication Date: 2022-03-29
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are relatively few functional studies of such proteins in soybean

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of soybean histone demethylase GmJMJ30-2 in regulation and control of stress tolerance of plants
  • Application of soybean histone demethylase GmJMJ30-2 in regulation and control of stress tolerance of plants
  • Application of soybean histone demethylase GmJMJ30-2 in regulation and control of stress tolerance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1. Obtaining and Stress Tolerance Identification of GmJMJ30-2 Transgenic Soybean Hairy Roots

[0063] 1. Obtaining hairy roots of transgenic GmJMJ30-2 soybean

[0064] 1. The cDNA clone of soybean histone demethylase GmJMJ30-2 coding gene GmJMJ30-2

[0065] 1) The stress-tolerant soybean variety Nannong 1138-2 was cultured under light, and after two weeks of growth, the seedlings were taken to extract RNA respectively. The specific extraction method is as follows: Grind 1 g of fresh seedlings in liquid nitrogen, suspend in 4mol / L guanidine sulfide, extract the mixture with acid phenol and chloroform, add absolute ethanol to the supernatant to precipitate total RNA, and then dissolve in water , to obtain total RNA.

[0066] 2) Synthesize cDNA by reverse transcription with reverse transcriptase.

[0067] 3) Using the cDNA obtained by reverse transcription as a template, PCR amplification was performed using primers JMJ30-2L: ATGTCGACCACAACTGTATC and primer JMJ3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of soybean histone demethylase GmJMJ30-2 in regulation and control of stress tolerance of plants. According to the invention, the transgenic soybean hairy root with overexpression of GmJMJ30-2 is obtained by adopting an agrobacterium rhizogenes infection method. Experiments prove that under the stress of salt and drought, the water content of chimera leaves of hairy roots of transgenic soybeans overexpressing GmJMJ30-2 is obviously higher than that of a control group. Therefore, the GmJMJ30-2 protein has the function of regulating the stress tolerance of the plants, especially improves the salt tolerance and drought tolerance of the plants, and lays a foundation for cultivating stress-tolerant plant varieties.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of soybean histone demethylase GmJMJ30-2 in regulating plant stress tolerance. Background technique [0002] Changes in physical and chemical factors in the environment, such as drought, salinity, chilling damage, freezing damage, waterlogging and other stress factors are one of the reasons for severe crop yield reduction. During the 40 years from 1939 to 1978 in the United States, the insurance industry’s compensation statistics for crop production reduction showed that the proportion of compensation for production reduction due to salt damage and drought accounted for about 40.8%, which was higher than that of waterlogging (16.4%) and low temperature (13.8%). , hail (11.3%) and wind (7.0%) are much higher than pests (4.5%), diseases (2.7%) and other factors. Therefore, breeding salt / drought tolerant crops is one of the main goals of the crop industry. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/13C12N15/82A01H5/00A01H6/54
CPCC12N9/0071C12N15/8273
Inventor 张劲松陈受宜韦伟张万科陶建军林晴阴翠翠
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI