Unlock instant, AI-driven research and patent intelligence for your innovation.

Protein OsERF096 related to plant stress tolerance and coding gene and application of protein OsERF096

A technology for plant stress tolerance and coding genes, which is applied in the field of protein OsERF096 and its coding genes and applications, and can solve problems that have not been reported yet.

Pending Publication Date: 2021-07-23
HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although many studies have reported that the rice AP2 / ERF transcription factor is involved in the regulation of response to abiotic stress, but there is no report on OsERF096

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein OsERF096 related to plant stress tolerance and coding gene and application of protein OsERF096
  • Protein OsERF096 related to plant stress tolerance and coding gene and application of protein OsERF096
  • Protein OsERF096 related to plant stress tolerance and coding gene and application of protein OsERF096

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0095] Example 1, Analysis of the expression pattern of OsERF096 under cold stress

[0096] The three-leaf stage rice (Nipponbare) seedlings were cold-treated at 4°C, and the aboveground tissues were collected at 0, 0.5, 1, 3, 6, 9, 12, and 24 hours respectively. Total RNA was extracted by Trizol method, and the reverse transcription kit SuperScript was used to extract total RNA. TM cDNA was obtained by reverse transcription with III ReverseTranscriptase kit (Invitrogen, Carlsbad, CA, USA). The obtained cDNA was diluted 5 times as a template, and the primer pair OsERF096-qRT-F and OsERF096-qRT-R were used for qRT-PCR detection. Rice elongation factor 1-α gene (elongation factor 1-gene) osa-ELF1-α was used as an internal reference gene. The primer sequences used for detection are as follows:

[0097] OsERF096-qRT-F: TGAGGGAGGTGAAGAAGGAGAG;

[0098] OsERF096-qRT-R: TGAGCAGCAATAGAACGAAAGAAT;

[0099] osa-ELF1-α-qRT-F: CATGATCACCGGTACCTCG;

[0100] osa-ELF1-α-qRT-R:CCAGCATGT...

Embodiment 2

[0102] Example 2, Obtaining of OsERF096 Overexpression Transgenic Rice and Analysis of Its Cold Tolerance

[0103] 1. Obtaining and identification of OsERF096 overexpression transgenic rice

[0104] 1. Using rice (Nipponbare) cDNA as a template, using primers to carry out PCR amplification to OsERF096-OX-U-F / OsERF096-OX-U-R, obtain PCR product (OsERF096 fragment), the detection result of PCR product is as follows figure 2 -B is shown. The amplification primers are as follows (the underline represents the linker sequence required for vector construction, where U is the USER restriction site):

[0105] OsERF096-OX-U-F: 5'- GGCTTAAU GGCCGGCTTCG-3';

[0106] OsERF096-OX-U-R: 5'- GGTTTAAU TCTGTTTAATCATCAAATAGCATAGTC-3'.

[0107] 2, the PCR product that step 1 obtains is connected in the pCAMBIA330035sU plant expression vector, obtains the recombinant expression vector pCAMBIA330035sU-OsERF096 ( figure 2 -A). The specific steps are as follows: the pCAMBIA330035Su vector i...

Embodiment 3

[0136] Embodiment 3, the acquisition of OsERF096-RNAi transgenic rice and its cold tolerance analysis

[0137] 1. Obtaining and identification of OsERF096-RNAi transgenic rice

[0138] 1. Design of OsERF096-siRNA sequence

[0139] According to the OsERF096 sequence, use Invitrogen's online RNAi design software: BLOCK-iT RNAiDesigner to design the OsERF096-RNAi interference sequence (OsERF096-siRNA sequence), the OsERF096-siRNA sequence is as follows:

[0140] TAAATCACGTGTTCTGAGCGGCAGGAGATTCAGTTTGAAGCTGGACTTCACTTTTTGCCTCTCTCCGCTGAGATCACGTGATTTA (sequence 4), see Figure 5 -B.

[0141] 2. Construction of OsERF096 gene silencing vector OsERF096-RNAi

[0142] 1) According to the OsERF096-siRNA sequence designed in step 1, entrust the company to synthesize the following double-stranded DNA: TAAATCACGTGTTCTGAGCGGCAGGAGATTCAGTTTGAAGCTGGACTTCACTTTTGCCTCTCTCCGCTGAGATCACGTGATTTA, and then connect the double-stranded DNA to the pBWA(V)HS-ami vector by recombinase to obtain pBWA(V)HS-a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein OsERF096 related to plant stress tolerance and a coding gene and application of the protein OsERF096. The OsERF096 protein is a protein with an amino acid sequence as shown in a sequence 3. According to the protein OsERF096, a DNA molecule for coding the OsERF096 protein is introduced into a target plant to obtain OsERF096-OX transgenic rice. The DNA molecule for interfering the expression of the OsERF096 gene is introduced into the target plant to obtain OsERF096-RNAi transgenic rice. Experiments prove that compared with wild rice, the cold resistance of the OsERF096-OX transgenic rice is lower than that of a receptor plant, and the cold resistance of the OsERF096-RNAi transgenic rice is higher than that of the receptor plant. It is shown that the OsERF096 protein has the function of regulating and controlling the plant cold tolerance and has great value for cultivating stress-tolerant plants and increasing the plant yield.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a protein OsERF096 related to plant stress tolerance, its coding gene and application. Background technique [0002] Rice (Oryza sativa L.), native to China, is one of the most important food crops in the world. Rice is the most important food crop in China, its output ranks first among food crops, and its sown area accounts for 1 / 3 of the total area of ​​food crops. Chilling injury, as an adversity stress, has a serious impact on rice at all stages, and is the main limiting factor in rice production in China. Severe low temperature and cold damage can lead to an average annual output reduction of 5-10 billion kg in the main japonica rice producing areas in Northeast China, accounting for about 20% of the normal annual total output. Low temperature at the heading and flowering stage of rice will reduce the seed setting rate of rice and seriously affect the nutritional qu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/113A01H4/00A01H5/00A01H6/46
CPCC07K14/415C12N15/113C12N15/8273C12N15/8218C12N15/8261C12N2310/14
Inventor 孙明哲孙晓丽沈阳陈悦才晓溪贾博为冷月
Owner HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY