Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Infective cloning vector of rape mosaic virus as well as construction method and application of infectious cloning vector

A technology of cloning vectors and leaf viruses, applied in the field of genetic engineering, can solve the problems of inability to guarantee the purification effect of disease samples, time-consuming and labor-intensive problems, etc.

Active Publication Date: 2022-04-19
PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The infectivity of different strains of YoMV is quite different. Although there are reports of YoMV strains and their full-length sequences in China, there is no report of invasive clones. The research on YoMV is only limited to using preserved disease samples for friction inoculation. It is time-consuming and labor-intensive, and the purification effect of disease samples cannot be guaranteed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Infective cloning vector of rape mosaic virus as well as construction method and application of infectious cloning vector
  • Infective cloning vector of rape mosaic virus as well as construction method and application of infectious cloning vector
  • Infective cloning vector of rape mosaic virus as well as construction method and application of infectious cloning vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Cloning of virus and construction of vector

[0023] Three radish disease samples suspected to be infected with YoMV were collected from the field, and the symptoms were yellowing, mosaic leaves, and short plants ( figure 1 ).

[0024] Total RNA was extracted, and primers were designed according to the conserved region of the known virus sequence: F: aatatcagagagcggcattctat (SEQ ID No.1), R: ctgtcggtaaaagtgcaatataact (SEQ ID No.2), RT-PCR detection, and it was found that the target item could be detected in sample 3 bring ( figure 2 ), samples 1, 2 and the asymptomatic CK control did not expand the band ( figure 2 ), indicating that sample 3 was infected with YoMV.

[0025] Using the cDNA of sample 3 as a template, the full-length YoMV was divided into two segments, and primers were designed to amplify the full-length YoMV sequence. 前半段引物:F1:aagttcatttcatttggagagggttttatttttattgcaacaacaacaa(SEQ ID No.3),R1:tgaacactgtgtcgatctgtaattgctattgggtccccga(SEQ ID N...

Embodiment 2

[0028] Example 2 YoMV invasive clone transforms Agrobacterium and infects tobacco

[0029] Transform GV3101 Agrobacterium with 0.5 μg of YoMV full-sequence invasive cloning plasmid. After the Agrobacterium transformants grow out, pick a single colony for colony PCR, and pick positive clones for shake-up preservation; name it YoMV-GD (Agrobacterium tumefaciens) , and preserved. The preservation unit is Guangdong Microbial Culture Collection Center (GDMCC), address: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, Compound, No. 100 Xianlie Middle Road, Guangzhou, Zip code 510070; preservation date: January 20, 2022, preservation number It is GDMCC No.62229.

[0030] Activation of the preserved YoMV-GD invasive cloning vector ( Figure 4 ) of Agrobacterium, cultivated at 28°C for 14-16h, collected the bacteria, suspended in Agrobacterium suspension buffer, and stood at 28°C for 2-4h. Measure the OD600 with a spectrophotometer, then adjust the O...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a rape mosaic virus infectious cloning vector as well as a construction method and application thereof. The technical problem to be solved by the invention is to provide a new choice for screening resistant varieties. According to the technical scheme, the infectious cloning vector for the rape mosaic virus is derived from a strain Agrobacterium tumefaciens YoMV-GD, and the preservation number of the infectious cloning vector is GDMCC No: 62229. A new strain of rape mosaic virus is screened, a rape mosaic virus infectious cloning vector is constructed, the vector is converted into agrobacterium, and then the rape mosaic virus can be inoculated by utilizing an agrobacterium injection method. And a foundation is laid for screening rape mosaic virus resistant materials and varieties and researching a rape mosaic virus genome structure, pathogenicity and interaction with hosts.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a rapeseed mosaic virus infectious cloning vector and its construction method and application. Background technique [0002] Youcai mosaic virus (YoMV) was first discovered in Chinese rapeseed in 1958 (Wei Jingchao et al., 1958). , Solanaceae and other plants (Ju et al., 2019), have been reported in China, South Korea, Japan, Germany, Switzerland, Spain, the United Kingdom and other countries, causing serious harm to the production of cruciferous crops and horticultural crops ( Zhu et al., 2001; Kwon et al., 2018; Liu Yong et al., 2019). [0003] YoMV belongs to the genus Tobacco Mosaic Virus, which is easily transmitted through seed contamination and mechanical friction. YoMV encodes four proteins, 125 kDa replication-associated protein, 182 kDa replicase, 30 kDa motor protein, and 17.7 kDa coat protein. Although YoMV can infect many cruciferous plants...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84C12N15/40C12Q1/18A01G7/06C12R1/94
CPCC12N15/8205C07K14/005C12Q1/18A01G7/06C12N2770/00022C12N2770/00052G01N2333/08
Inventor 李正刚汤亚飞何自福佘小漫于琳蓝国兵
Owner PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com