Construction method and application of ARHGAP11B gene deleted iPSC cell line
A construction method and cell line technology, applied in microorganism-based methods, genetically modified cells, artificially induced pluripotent cells, etc., can solve the problems of constructing and knocking out induced pluripotent stem cells ARHGAP11B gene, etc., and achieve gene improvement. Editing Efficiency, Efficiency Improvement, and Complete Knockout Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1. A construction method for knocking out the ARHGAP11B gene in iPSC cell lines based on the CRISPR / Cas9 system
[0048] 1. sgRNA design
[0049] "sgRNA", that is, Single guide RNA, single guide RNA, can recognize specific genome fragments during CRISPR / Cas9 gene editing (including gene knockout). According to the principle of sgRNA target sequence design, the target sequence was designed in exon 6 of the human ARHGAP11B gene (the nucleotide sequence is shown in SEQ ID No.1), and three sgRNAs were constructed, namely sgRNA1, sgRNA2 and sgRNA3, with nucleotide sequences As shown in SEQ ID No.2-4 respectively (see Table 1), the sequence diagrams of the three sgRNAs are shown in figure 1 shown.
[0050] Table 1
[0051] sgRNA ID Nucleotide sequence sgRNA1 gcgtgtaccagactttatcc sgRNA2 ggaaaagataccagccatgt sgRNA3 gactttatcctggaaaagat
[0052] 2. Construction of CRISPR / Cas9 vector
[0053] The three sgRNAs were annealed to form...
Embodiment 2
[0142] Example 2. Identification and analysis of pluripotency of iPSC cell lines with ARHGAP11B gene deletion
[0143] (1) Cell immunofluorescence
[0144] The cells (iPSC63, wild-type WT iPSC) were respectively passaged to three wells of a four-well plate, and the immunofluorescence experiment was started after the cell density reached 70%-80%.
[0145] 1) Aspirate the culture medium in the four-well plate, soak it with PBS for 3 times, each time for 10 min;
[0146] 2) Fix the cells with 4% paraformaldehyde for 20 minutes, soak in PBS for 3 times, 10 minutes each time;
[0147] 3) Add 0.5% Trition X-100 (prepared in PBS) to permeate at room temperature for 20 minutes, soak in PBS for 3 times, each time for 10 minutes;
[0148] 4) Drain the PBS, add dropwise normal goat serum, and block at room temperature for 30 minutes;
[0149] 5) Blot up the blocking solution, directly add 200 μl of diluted primary antibody (Oct4, Sox2, Nanog) to each well, and incubate overnight at 4°...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


