Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of lettuce LsSAW1 gene in controlling heading character of lettuce

A gene and technology of lettuce, applied in the field of lettuce LsSAW1 gene and its application in controlling lettuce heading traits, can solve problems such as unclear regulatory network

Pending Publication Date: 2022-05-27
HUAZHONG AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Yu et al. cloned a gene LsKN1 controlling heading traits of lettuce through genetic mapping, and LsKN1 became the first gene controlling heading traits identified in lettuce, but the regulatory network of heading traits in lettuce is still unclear (Yu et al .2020)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of lettuce LsSAW1 gene in controlling heading character of lettuce
  • Application of lettuce LsSAW1 gene in controlling heading character of lettuce
  • Application of lettuce LsSAW1 gene in controlling heading character of lettuce

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] The acquisition of lettuce head gene LsSAW1:

[0024] 1. Genetic Analysis of Heading Traits of Lettuce

[0025] In order to analyze the genetic rule of lettuce heading traits, the present invention adopts head lettuce (PI536839) and non-heading lettuce (PI344074) to obtain F. 1 Generation Hybrid, F 1 Generation hybrids are selfed to obtain F 2 Generation groups (Yu et al. 2020). to F 2 Statistical analysis of the heading phenotype was carried out for each individual in the generation group, and the heading trait showed a continuous distribution from "tight head" to "loose head", and then to "no head", which proved that the head characteristic of lettuce was a Quantitative traits controlled by polygenes.

[0026] Using BSA combined with RNA-seq method to analyze F 2 The nodularity of the population was genetically analyzed. in F 2 In the isolated population, 20 individuals with good nodulation were selected to construct a "balling pool", and 20 non-balling indivi...

Embodiment 2

[0031] Application of head gene LsSAW1 in lettuce head:

[0032](1) Using non-heading lettuce (PI344074) as a template, using primers: AGH601F: atggaagtagccagattccaa and AGH672R: ctaactgaaaaaagacgtttt, the amplified target fragment is the sequence shown in SEQ ID NO.1, which is inserted by the method of homologous recombination into the pRI101 plant expression vector (vector linearized with EcoRI) and transformed head lettuce under Agrobacterium tumefaciens. Using transgenic detection primers: M13F: gtaaaacgacggccagt; AGH607R: cgtcgctaattcttaattcc to detect transgenic plants, a total of 3 transgenic plants were obtained, and all 3 transgenic plants showed a non-heading phenotype ( image 3 Middle (a) left second shows the phenotype of one of the transgenic plants, LsSAW1-OX#1). T for one of the transgenic lines 1 The head phenotype and genotype analysis showed that the individual plants with transgene insertion showed no head phenotype, while the individual plants without tr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant engineering, and discloses an application of a lettuce LsSAW1 gene in controlling the heading character of lettuce, and the gene is shown as SEQ ID NO.1. The result of knocking out the LsSAW1 gene in the non-heading lettuce by virtue of a CRISPR-Cas9 technology shows that the LsSAW1 gene with lost functions can enable the non-heading lettuce to be heading. The LsSAW1 gene is transformed into the heading lettuce through agrobacterium tumefaciens mediation, and the result shows that the LsSAW1 can convert the heading lettuce into the non-heading lettuce. Cloning of the LsSAW1 gene opens up a new direction for research on plant leaf development and leaf dorsal ventral property, and meanwhile gene resources and theoretical guidance are provided for variety breeding of heading vegetables.

Description

technical field [0001] The invention belongs to the technical field of plant engineering, and in particular relates to an isolated lettuce LsSAW1 gene and its application in controlling the heading traits of lettuce. Background technique [0002] Lettuce (Lactuca sativa L.) is a plant of the genus Asteraceae, native to the Mediterranean region, and is an important vegetable crop in my country. Lettuce can be further divided into leaf lettuce (Lactucasativa Linn.var.ramosa Hort.) and stem lettuce (LactucasativaLinn.var.angustata Irish ex Bremer) according to its different shapes and edible parts. Head lettuce is a very important type of leaf lettuce, which is characterized by the inward curling of the head leaves and wrapping layer by layer, thereby forming a spherical structure composed of leaves, that is, a leaf ball. Compared with other leaf lettuce, head lettuce is easy to harvest and transport, has better taste and longer shelf life, so it is favored by growers and cons...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C07K14/415C12Q1/6895A01H5/00A01H6/14
CPCC07K14/415C12N15/8218C12N15/8261C12Q1/6895C12Q2600/13Y02A40/146
Inventor 匡汉晖安光辉陈炯炯余长春严承欢
Owner HUAZHONG AGRI UNIV