SNP (Single Nucleotide Polymorphism) marker for identifying genetic sex of coilia ectenes as well as primer and application thereof
A technology of cuttlefish and sex, which is applied to the SNP markers for identifying the genetic sex of cuttlefish and its primers and application fields, can solve the problems of inability to carry out comparisons and the difficulty of screening gender-related markers in cuttlefish, so as to improve breeding and economic benefits, Simple operation, overcome the effect of cumbersome operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Development and validation of sex-specific SNP markers
[0028] Anchovy is a diploid organism and has a ZW / ZZ sex determination system, with females being ZW and males being ZZ. By comparing and analyzing the 2b-RAD sequencing data of 10 groups of male and female scorpionfish from the breeding population of Jiangzhiyuan Fishery Technology Co., Ltd. in Zhenjiang City, Jiangsu Province, a large number of SNP markers were found between male and female fish. The 10 SNP markers most significantly correlated with the sex difference of the scorpionfish were screened and verified, and one of the SNP markers showed accurate sex-specificity.
[0029] The results are shown in Table 1, showing that in the sequence from female fish figure 1 The shown SNP site has two bases T / G, and the sequence from male fish does not have SNP polymorphism at this site, and all sequences have T bases at this site.
[0030] Table 1 SNP molecular marker information obtained by screening
[0031] ...
Embodiment 2
[0037] Sequencing of PCR products to preliminarily verify the accuracy of SNP loci
[0038]In this example, 44 samples (22 males and 22 males) from the breeding population of Jiangzhiyuan Fishery Technology Co., Ltd., Zhenjiang City, Jiangsu Province, were used for male and female identification.
[0039] Use alcohol-sterilized scissors to cut off the caudal fins of the caudal fins of the scallops, about 0.5 × 0.5 cm, and store them in anhydrous ethanol at 4°C. The fin ray genomic DNA was extracted by the ammonium acetate method. Genomic DNA quality was detected by 1.0% agarose gel electrophoresis, concentration was detected by ultraviolet spectrophotometer (Eppendorf, type AG2231), and stored at -20°C for later use.
[0040] The PCR amplification reaction system is:
[0041]
[0042] Forward primer: gcacaaagttgcactgttcc
[0043] Reverse primer: atgcacaacacggatcttgc
[0044] The PCR amplification reaction program was as follows: pre-denaturation at 94°C for 5 min; denat...
Embodiment 3
[0051] Sequencing PCR products and expanding samples to verify the accuracy of SNP loci
[0052] In this example, 48 samples (33 females and 15 males) from 3 populations (with determined genetic sex) were used for sex identification. Group 1 is the breeding group of Jiangzhiyuan Fishery Technology Co., Ltd., Zhenjiang City, Jiangsu Province (15 females, 1 male), and group 2 is the breeding group of Wuhan Hengyuxin Technology Breeding Professional Cooperative in Wuhan City, Hubei Province (4 females, 10 males) ; Group 3 is the wild group of Yezhi Lake in Hubei Province (14 females and 4 males).
[0053] Use alcohol-sterilized scissors to cut off the caudal fins of the caudal fins of the scallops, about 0.5 × 0.5 cm, and store them in anhydrous ethanol at 4°C. The fin ray genomic DNA was extracted by the ammonium acetate method. Genomic DNA quality was detected by 1.0% agarose gel electrophoresis, concentration was detected by ultraviolet spectrophotometer (Eppendorf, type AG2...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap