SNP (Single Nucleotide Polymorphism) marker for identifying genetic sex of coilia ectenes as well as primer and application thereof

A technology of cuttlefish and sex, which is applied to the SNP markers for identifying the genetic sex of cuttlefish and its primers and application fields, can solve the problems of inability to carry out comparisons and the difficulty of screening gender-related markers in cuttlefish, so as to improve breeding and economic benefits, Simple operation, overcome the effect of cumbersome operation

Active Publication Date: 2022-07-15
HUAZHONG AGRI UNIV +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Judging from the genome information published at this stage, there is only the female Anchovy genome and annotation files (Xue et al., 2020), and there is no male-related information, so it is impossible to directly compare the genomes of the two sexes. It has brought certain difficulties to the screening of sex-related markers in the anchovy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP (Single Nucleotide Polymorphism) marker for identifying genetic sex of coilia ectenes as well as primer and application thereof
  • SNP (Single Nucleotide Polymorphism) marker for identifying genetic sex of coilia ectenes as well as primer and application thereof
  • SNP (Single Nucleotide Polymorphism) marker for identifying genetic sex of coilia ectenes as well as primer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Development and validation of sex-specific SNP markers

[0028] Anchovy is a diploid organism and has a ZW / ZZ sex determination system, with females being ZW and males being ZZ. By comparing and analyzing the 2b-RAD sequencing data of 10 groups of male and female scorpionfish from the breeding population of Jiangzhiyuan Fishery Technology Co., Ltd. in Zhenjiang City, Jiangsu Province, a large number of SNP markers were found between male and female fish. The 10 SNP markers most significantly correlated with the sex difference of the scorpionfish were screened and verified, and one of the SNP markers showed accurate sex-specificity.

[0029] The results are shown in Table 1, showing that in the sequence from female fish figure 1 The shown SNP site has two bases T / G, and the sequence from male fish does not have SNP polymorphism at this site, and all sequences have T bases at this site.

[0030] Table 1 SNP molecular marker information obtained by screening

[0031] ...

Embodiment 2

[0037] Sequencing of PCR products to preliminarily verify the accuracy of SNP loci

[0038]In this example, 44 samples (22 males and 22 males) from the breeding population of Jiangzhiyuan Fishery Technology Co., Ltd., Zhenjiang City, Jiangsu Province, were used for male and female identification.

[0039] Use alcohol-sterilized scissors to cut off the caudal fins of the caudal fins of the scallops, about 0.5 × 0.5 cm, and store them in anhydrous ethanol at 4°C. The fin ray genomic DNA was extracted by the ammonium acetate method. Genomic DNA quality was detected by 1.0% agarose gel electrophoresis, concentration was detected by ultraviolet spectrophotometer (Eppendorf, type AG2231), and stored at -20°C for later use.

[0040] The PCR amplification reaction system is:

[0041]

[0042] Forward primer: gcacaaagttgcactgttcc

[0043] Reverse primer: atgcacaacacggatcttgc

[0044] The PCR amplification reaction program was as follows: pre-denaturation at 94°C for 5 min; denat...

Embodiment 3

[0051] Sequencing PCR products and expanding samples to verify the accuracy of SNP loci

[0052] In this example, 48 samples (33 females and 15 males) from 3 populations (with determined genetic sex) were used for sex identification. Group 1 is the breeding group of Jiangzhiyuan Fishery Technology Co., Ltd., Zhenjiang City, Jiangsu Province (15 females, 1 male), and group 2 is the breeding group of Wuhan Hengyuxin Technology Breeding Professional Cooperative in Wuhan City, Hubei Province (4 females, 10 males) ; Group 3 is the wild group of Yezhi Lake in Hubei Province (14 females and 4 males).

[0053] Use alcohol-sterilized scissors to cut off the caudal fins of the caudal fins of the scallops, about 0.5 × 0.5 cm, and store them in anhydrous ethanol at 4°C. The fin ray genomic DNA was extracted by the ammonium acetate method. Genomic DNA quality was detected by 1.0% agarose gel electrophoresis, concentration was detected by ultraviolet spectrophotometer (Eppendorf, type AG2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of SNP markers, and particularly discloses an SNP marker for identifying genetic sex of coilia ectenes as well as a primer and application of the SNP marker. According to the invention, the coilia ectenes gender specific SNP marker is successfully screened by a 2b-RAD sequencing method, and the marker is located at the 12186257th basic group on the LG18 chromosome of the coilia ectenes. Aiming at the SNP marker, a primer is designed, and the genetic sex of the coilia ectenes can be accurately and rapidly identified by using conventional PCR amplification and Sanger sequencing. Compared with previous dissection detection and gonad slice observation, the technology has the advantages of being accurate, simple, rapid, small in damage to fish bodies and the like, solves the problem of coilia ectenes sex identification, is beneficial to large-scale cultivation of a coilia ectenes all-female system, and provides a powerful basis for development of the coilia ectenes breeding industry.

Description

technical field [0001] The invention relates to the field of SNP markers, in particular to a SNP marker for identifying the hereditary sex of conifers, primers and applications thereof. Background technique [0002] Coilia nasus, scientific name of Coilia nasus, belongs to Chordate, Bonefish, Herring, Anchovy, and Anchovy. It is a small and medium-sized anadromous fish in the Yangtze River in my country. Value and economic value, together with the shad (Tenualosa reevesii) and the dark-striped puffer (Takifugu fasciatus), are also known as "three fresh products of the Yangtze River". There is a significant dimorphism between male and female growth, and the growth rate of females of the same period is significantly faster than that of males, and the females are also larger than males when they reach maturity. Therefore, it is of great industrial significance to develop the all-female breeding and all-female breeding technology of C. However, before the gonads mature, it is d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6879C12Q1/6888C12Q1/6858C12N15/11
CPCC12Q1/6879C12Q1/6888C12Q1/6858C12Q2600/156C12Q2531/113C12Q2535/101Y02A40/81
Inventor 高泽霞徐子升罗丽飞万世明许柯昕滕金梦顾树信
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap