Nucleic acid molecule of codon-optimized T4 polynucleotide kinase and expression method of nucleic acid molecule
A technology of polynucleotide and nucleic acid molecules, applied in the direction of microorganism-based methods, biochemical equipment and methods, botany equipment and methods, etc., can solve the problems of restricting the production and application of T4PNK
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Example 1 Codon Optimization
[0061] Based on the codon preference of the E.coli expression system, factors such as GC content, codon balance, mRNA secondary structure, nuclease cleavage sites, trans-acting element binding, and enzyme cleavage site avoidance were comprehensively evaluated. The full-length nucleotide sequence of the T4 PNK gene derived from T4 phage was optimized, and the optimized sequence was named OPT-PNK. See the comparison results with the unoptimized sequence (WT-PNK). figure 1 .
[0062] The full length of WT-PNK is 906bp, encoding 301 amino acids. The sequence table is shown in SEQ ID NO: 03 below, wherein SEQ ID NO: 03 is:
[0063] ATGAAAAAGATTATTTTGACTATTGGCTGTCCTGGTTCTGGTAAGAGTACTTGGGCTCGTGAATTTATTGCTAAGAATCCCGGGTTTTATAATATCAATCGTGATGACTATCGCCAATCTATTATGGCGCATGAAGAACGCGATGAGTACAAGTATACCAAAAAGAAAGAAGGTATCGTAACTGGTATGCAGTTTGATACAGCTAAAAGTATTCTGTACGGTGGCGATTCTGTTAAGGGAGTAATCATTTCAGATACTAACCTGAATCCTGAACGTCGCCTAGCATGGGAAACTTTTGCCAAAGAATACGGCTGGA...
Embodiment 2
[0065]Example 2 Construction of expression vector
[0066] 2.1 Design primers As shown in Table 1, clone the SUMO full-length fragment without stop codon from the genome of Saccharomyces cerevisiae, add NdeI recognition site at the 5' end, and add NheI recognition site at the 3' end; amplification; After the product was sequenced correctly, double-enzyme digestion was performed with NdeI / NheI, and the digested product was recovered for use;
[0067] Table 1 SUMO tag cloning primers
[0068]
[0069] 2.2 Double-enzyme digestion of pET28b was carried out with NdeI / NheI at the same time, and the digested vector fragment was recovered;
[0070] 2.3 The double-enzyme digested vector and SUMO gene were ligated, transformed into DH5α, positive clones were picked, cultured, plasmids were extracted, digested and sequenced for verification; pET28b with SUMO gene fragments inserted between NdeI and NheI sequences was the downstream requirement. The purpose vector used, named pET28b-...
Embodiment 3
[0075] Example 3 Induced expression of recombinant protein
[0076] 20ng of pET28b-WT and pET28b-SUMO-OPT plasmids were taken, transformed into BL21(DE3) competent cells, heat-shocked, recovered, spread on a plate containing 50 μg / ml kanamycin, and incubated overnight at 37°C in the dark;
[0077] Pick the transformants, inoculate into 15ml LB liquid medium containing 50μg / ml kanamycin, 37℃, 250rpm shaking culture to OD600≈1.0;
[0078] 1:200 was inoculated into 3L SB medium, 37°C, 250rpm shaking culture to OD600≈1.0, IPTG (final concentration 1mM) was added, 12°C, 200rpm induced 22hrs, the cells were collected, and temporarily stored at -80°C.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


