Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid molecule of codon-optimized T4 polynucleotide kinase and expression method of nucleic acid molecule

A technology of polynucleotide and nucleic acid molecules, applied in the direction of microorganism-based methods, biochemical equipment and methods, botany equipment and methods, etc., can solve the problems of restricting the production and application of T4PNK

Pending Publication Date: 2022-08-02
ANNOROAD GENE TECH BEIJING +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, building a stable and efficient T4 PNK recombinant expression system is an inevitable choice for the molecular biology product market. However, in the pET expression system that is generally applicable at present, the recombinant product of T4 PNK mainly exists in the form of inclusion bodies, which severely limits the ability of T4 PNK. The production and application of PNK; and the high isoelectric point of T4 PNK constitutes a restriction factor for the isolation, purification and in vitro storage of recombinant protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid molecule of codon-optimized T4 polynucleotide kinase and expression method of nucleic acid molecule
  • Nucleic acid molecule of codon-optimized T4 polynucleotide kinase and expression method of nucleic acid molecule
  • Nucleic acid molecule of codon-optimized T4 polynucleotide kinase and expression method of nucleic acid molecule

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1 Codon Optimization

[0061] Based on the codon preference of the E.coli expression system, factors such as GC content, codon balance, mRNA secondary structure, nuclease cleavage sites, trans-acting element binding, and enzyme cleavage site avoidance were comprehensively evaluated. The full-length nucleotide sequence of the T4 PNK gene derived from T4 phage was optimized, and the optimized sequence was named OPT-PNK. See the comparison results with the unoptimized sequence (WT-PNK). figure 1 .

[0062] The full length of WT-PNK is 906bp, encoding 301 amino acids. The sequence table is shown in SEQ ID NO: 03 below, wherein SEQ ID NO: 03 is:

[0063] ATGAAAAAGATTATTTTGACTATTGGCTGTCCTGGTTCTGGTAAGAGTACTTGGGCTCGTGAATTTATTGCTAAGAATCCCGGGTTTTATAATATCAATCGTGATGACTATCGCCAATCTATTATGGCGCATGAAGAACGCGATGAGTACAAGTATACCAAAAAGAAAGAAGGTATCGTAACTGGTATGCAGTTTGATACAGCTAAAAGTATTCTGTACGGTGGCGATTCTGTTAAGGGAGTAATCATTTCAGATACTAACCTGAATCCTGAACGTCGCCTAGCATGGGAAACTTTTGCCAAAGAATACGGCTGGA...

Embodiment 2

[0065]Example 2 Construction of expression vector

[0066] 2.1 Design primers As shown in Table 1, clone the SUMO full-length fragment without stop codon from the genome of Saccharomyces cerevisiae, add NdeI recognition site at the 5' end, and add NheI recognition site at the 3' end; amplification; After the product was sequenced correctly, double-enzyme digestion was performed with NdeI / NheI, and the digested product was recovered for use;

[0067] Table 1 SUMO tag cloning primers

[0068]

[0069] 2.2 Double-enzyme digestion of pET28b was carried out with NdeI / NheI at the same time, and the digested vector fragment was recovered;

[0070] 2.3 The double-enzyme digested vector and SUMO gene were ligated, transformed into DH5α, positive clones were picked, cultured, plasmids were extracted, digested and sequenced for verification; pET28b with SUMO gene fragments inserted between NdeI and NheI sequences was the downstream requirement. The purpose vector used, named pET28b-...

Embodiment 3

[0075] Example 3 Induced expression of recombinant protein

[0076] 20ng of pET28b-WT and pET28b-SUMO-OPT plasmids were taken, transformed into BL21(DE3) competent cells, heat-shocked, recovered, spread on a plate containing 50 μg / ml kanamycin, and incubated overnight at 37°C in the dark;

[0077] Pick the transformants, inoculate into 15ml LB liquid medium containing 50μg / ml kanamycin, 37℃, 250rpm shaking culture to OD600≈1.0;

[0078] 1:200 was inoculated into 3L SB medium, 37°C, 250rpm shaking culture to OD600≈1.0, IPTG (final concentration 1mM) was added, 12°C, 200rpm induced 22hrs, the cells were collected, and temporarily stored at -80°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid molecule for coding T4 polynucleotide kinase, the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO: 01, the invention further discloses a recombinant vector and a host cell containing the nucleotide sequence, an expression method of the recombinant vector and the host cell, and application of the produced T4 polynucleotide kinase. The nucleic acid molecule of the T4 polynucleotide kinase, disclosed by the invention, provides a technical guarantee for the yield, purity and activity of the T4 polynucleotide kinase.

Description

technical field [0001] The present application relates to the technical field of genetic engineering, in particular, to a nucleic acid molecule of a codon-optimized T4 polynucleotide kinase and an expression method thereof. Background technique [0002] T4 PNK is a phosphokinase encoded by the pseT gene in T4 phage. It has both 5' phosphorylation activity and 3' dephosphorylation activity, and can catalyze the transfer of the γ-position phosphate group of ATP to the oligonucleotide chain (dsDNA). / ssDNA / RNA) on the 5'-OH terminus and 3'-monophosphate nucleoside, or by removing the 3'-phosphate group from the 3'-phosphate terminus of the oligonucleotide chain [1] . Therefore, T4 PNK has a wide range of application scenarios, such as catalyzing the phosphorylation state of DNA or RNA ends for downstream ligation reactions, or being used in probe and primer labeling systems, which play an indispensable role in the fields of sequencing and molecular hybridization. Therefore, t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N15/70C12N15/65C12N1/21C12N9/12C12R1/19
CPCC12N9/1205C12Y207/01078C12N15/70C12N15/65C12N2800/22
Inventor 龚晓洁赵军侯启如李志民王娟
Owner ANNOROAD GENE TECH BEIJING
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More