Process high effectively producing BPI-Fc recombinant protein

A recombinant protein, bpi-fc technology, applied in the field of genetic engineering, can solve the problems of influence, large molecules, and low expression of eukaryotic expression systems, achieve broad application prospects, and enhance the effect of killing G-bacteria.

Inactive Publication Date: 2004-08-25
CAPITAL UNIVERSITY OF MEDICAL SCIENCES +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Ig-like recombinant proteins have the characteristics of large molecules, many disulfide bonds, complex structures and functions, etc., and are generally expressed by eukaryotic expression systems in order to produce biological functions of natural proteins or their functional fragments through glycosylation modification and natural folding glycosylated recombinant protein; however, the eukaryotic expression system has problems such as low expression and high cost, which affect its practical application
There are glycosylation sites on BPI or its functional fragments and Fc fragments [Gray PW.et al.J Biol Chem.264:9505-9509.(1989)], while prokaryotic host cells do not glycosylate the expressed protein Modification, so far there is no report on the production of BPI-Fc recombinant protein using prokaryotic expression system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process high effectively producing BPI-Fc recombinant protein
  • Process high effectively producing BPI-Fc recombinant protein
  • Process high effectively producing BPI-Fc recombinant protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0022] 1. Cloning of BPI functional fragment gene and Fcγ1 fragment gene

[0023] 1. Cloning of BPI functional fragment gene: extract mRNA from promyelocytic leukemia HL-6 cell line (ATCC CCL240), use designed and synthesized human BPI gene primers (P1 5'CAGAATTCATGGTCAACCCTGGCGTCGTG 3' and P2 5'GCAAGCTTCTATTTTGGTCATTACTGGCAG 3' ) for RT-PCR amplification (reverse transcription at 48°C for 45 minutes, followed by 35 cycles of PCR amplification, with cycle parameters of denaturation at 94°C for 30 seconds, renaturation at 53.5°C for 40 seconds, and extension at 72°C for 45 seconds), to obtain an approximately 620bp BPI gene fragment BPI 620 ; Digest BPI with EcoR I / Hind III 620 Get the BPI gene fragment BPI of about 200bp 200 (EcoR I / EcoR I cohesive end) and the BPI gene fragment BPI of about 420bp 420 (EcoR I / HindIII cohesive end); According to the molecular cloning operation method [Sambrook J.et al.Molecular cloning:laboratory manual, second edition, 1989, Cold Spring Har...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A high-efficiency production method of BPI-Fc recombinant protein includes: (1). constituting BPI-Fc chimeric gene expression vector; and (2). expressing BPI-Fc recombinant protein in prokaryotic host cell. This invention also discloses a specific expression vector in the course of expressing BPI-Fc gamma I recombinant protein in prokaryotic expression system. Said invention possesses important value for developing novel high-effective infection-resisting biological preparation, and has extensive application in pharmaceutical industry.

Description

technical field [0001] The invention relates to a high-efficiency production method and application of recombinant protein in the field of genetic engineering. Background technique [0002] Bacterial drug resistance is the most serious and thorny problem encountered in clinical anti-infective treatment, and no effective solution has been obtained so far. According to clinical research reports, about half of infected patients are Gram-negative (G - ) bacterial infection, which develops into G - Bacterial sepsis (GNS) also has a relatively high rate of death from shock [Dahlberg PS, Acton RD and Battafarano RJ. J Surg Res. 63:44-8 (1996)]. Current conventional antibiotic therapy [Verhoef J, Hustinx WM, Frase H and Hoepelman AI.JAntimicrob Chemother.38(2):167-82(1996)] and the use of anti-lipopolysaccharide lipid A / inner core monoclonal antibody or anti-IL -1 / TNF monoclonal antibody for immunotherapy [Mccloskey RU, Straube RC, Sander C et al.Ann Intern Med.121:1 (1994)], the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K38/16C07K14/00C07K19/00C12N15/62C12N15/63C12N15/64
Inventor安云庆陈金栋
OwnerCAPITAL UNIVERSITY OF MEDICAL SCIENCES