Unlock instant, AI-driven research and patent intelligence for your innovation.

Selection marker

A selective, labeling technology that can be used in lyases, biochemical equipment and methods, bacteria, etc., and can solve problems such as expensive compounds

Inactive Publication Date: 2000-06-28
SYNGENTA MOGEN BV
View PDF10 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0013] - Some compounds are expensive only if added to make selection possible

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Selection marker
  • Selection marker
  • Selection marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] The cloning of the fungal gene of embodiment 1 coding cyanamide hydratase (CAH) in heterologous expression cassette a. is used for the member of transformation dicotyledon

[0066] Construct pMOG874 contains the coding region from the soil fungus Myromyces verrucosum cyanamide hydratase gene operably linked to the CaMV 35S promoter and the CaMV 35S terminator. This chimeric gene replaced the beta-glucuronidase coding region and the nopaline synthase terminator in the binary vector pBI101, (Jefferson et al. EMBO J. 6, 3901, 1987).

[0067] This construct was obtained by PCR using primers P1 and P2 between the XhoI and SstI sites of the plant expression vector pRT101 at 899 bp CAH (position 235-1197 of the sequence published by Maier-Greiner et al. (1991) USA Proceedings of the National Academy of Sciences, 88: 4260-4264) an XhoI site was added to the 5' end of the cDNA fragment, and a SstI site was added to its 3' end, P1: 5' ACCGAGCTCGAATTCGGCACGAGGTTGACATGATACTTCCTG3' ...

Embodiment 2

[0075] pMOG617 was made by cloning the hygromycin expression cassette from pMOG22 into the Hind III site of the high-copy vector pMOG18 ( Figure 9 ). The transformation of embodiment 2 potatoes

[0076]Described below is a method for transformation of potato (Solanamtubarosom cv. Kardal) stem segments with Agrobacterium tumefaciens. Explants of stem segments of potato plants grown in vitro 3-8 weeks after transformation were used. The plants were grown on multiple media (MUM) under a 16-hour light cycle (1700 lux) at 24°C and an 8-hour dark cycle at 21°C (the composition of the various media can be found in Table 2). Stem sections of approximately 5 mm were cut onto sterile filter paper soaked in wash medium (WAM) and collected in flasks containing wash medium. When approximately 300 explants were reached, the wash medium was replaced with pre-culture medium (PRM). The flasks were incubated for approximately 24 hours at 80 rpm under the same conditions as described above. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention is concerned with the use of cyanamide hydratase as a selection marker in plant transformation. Cyanamide acts as a herbicide and plants transformed with the gene coding for cyanamide hydratase are able to convert the cyanamide into urea which enables the selection of transformed plants by survival under cyanamide pressure.

Description

field of invention [0001] The present application relates to a new selectable marker, especially the use of cyanamide hydratase as a selectable marker in transformation experiments, especially in plant transformation experiments. Background technique [0002] Cyanamide (H 2 N—C≡N) is a derivative of cyanogen, which, like other cyanide derivatives, is used in agriculture for growth stimulation and plant protection. Cyanamide is used as a fertilizer in aqueous solution or in the form of its calcium salt by supplying ammonia to the soil through its metabolic transformation. However, it has additional advantages as a herbicide. To use it as a fertilizer, it must be applied before planting. [0003] Chemically, cyanamide belongs to cyanide compounds. Although compounds containing a cyano group occur relatively rarely in nature, enzymes that hydrate this group have been found in bacteria and plants (e.g., Nagasawa T. et al., 1988, Biochem.Biophys Research Communications (Bioch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01H5/00C12N1/21C12N5/10C12N9/88C12N15/09C12N15/60C12N15/82
CPCC12N9/88C12N15/8274C12N15/8209
Inventor B·达姆
Owner SYNGENTA MOGEN BV