Selection marker
A selective, labeling technology that can be used in lyases, biochemical equipment and methods, bacteria, etc., and can solve problems such as expensive compounds
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] The cloning of the fungal gene of embodiment 1 coding cyanamide hydratase (CAH) in heterologous expression cassette a. is used for the member of transformation dicotyledon
[0066] Construct pMOG874 contains the coding region from the soil fungus Myromyces verrucosum cyanamide hydratase gene operably linked to the CaMV 35S promoter and the CaMV 35S terminator. This chimeric gene replaced the beta-glucuronidase coding region and the nopaline synthase terminator in the binary vector pBI101, (Jefferson et al. EMBO J. 6, 3901, 1987).
[0067] This construct was obtained by PCR using primers P1 and P2 between the XhoI and SstI sites of the plant expression vector pRT101 at 899 bp CAH (position 235-1197 of the sequence published by Maier-Greiner et al. (1991) USA Proceedings of the National Academy of Sciences, 88: 4260-4264) an XhoI site was added to the 5' end of the cDNA fragment, and a SstI site was added to its 3' end, P1: 5' ACCGAGCTCGAATTCGGCACGAGGTTGACATGATACTTCCTG3' ...
Embodiment 2
[0075] pMOG617 was made by cloning the hygromycin expression cassette from pMOG22 into the Hind III site of the high-copy vector pMOG18 ( Figure 9 ). The transformation of embodiment 2 potatoes
[0076]Described below is a method for transformation of potato (Solanamtubarosom cv. Kardal) stem segments with Agrobacterium tumefaciens. Explants of stem segments of potato plants grown in vitro 3-8 weeks after transformation were used. The plants were grown on multiple media (MUM) under a 16-hour light cycle (1700 lux) at 24°C and an 8-hour dark cycle at 21°C (the composition of the various media can be found in Table 2). Stem sections of approximately 5 mm were cut onto sterile filter paper soaked in wash medium (WAM) and collected in flasks containing wash medium. When approximately 300 explants were reached, the wash medium was replaced with pre-culture medium (PRM). The flasks were incubated for approximately 24 hours at 80 rpm under the same conditions as described above. ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 