Process for screening compound having affinity for vitamin D receptor
A technology for compounds, vitamins, applied in the field of screening
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0094] The present invention will be described in more detail by the following examples, but the present invention is not limited by these examples. Example 1: Screening system (A) Evaluation of inhibitory activity of AP-1 complex and NF-κB family by reporter gene assay system (1) Reporter gene carrier with AP-1 binding sequence or NF-κB binding sequence
[0095] The base vector was constructed by inserting the promoter region (-72 / +47) of the human IL-2 gene into a luciferase cassette vector (pXP2; described in S.K. Nordeen, Biotechnology, 6, 454-456 (1988)). For the reporter gene vector containing the AP-1 binding sequence, five AP-1 binding sequences (ATGAGTCAG) of the human collagenase (MMP-1) gene were inserted in series into the base vector. For the reporter gene vector containing the NF-κB binding sequence, four kinds of NF-κB binding sequences (CAGAGGGGACTTTTCCGAGA) of the human immunoglobulin light chain κ gene were inserted in series into the basic vector. The resul...
Embodiment 2
[0116] The above results demonstrate the possibility of isolating the VDRE-mediated transcription-promoting activity of vitamin D derivatives from their inhibitory activity on the AP-1 complex or the NF-κB family. Example 2: Compound No. 22 and 1α, 25-dihydroxyvitamin D in osteoporosis model rats 3 Effect on bone mass reduction (subcutaneous treatment) (A) Experimental method
[0117] Ovariectomy was performed on 7-9 week old W-I female rats (Imamichi Institute of Animal Reproduction). 0.01-0.04 μg / kg 1α,25-dihydroxyvitamin D starting from the next day 3 Dose, or 0.01-0.1 μg / kg dose of Compound No. 22, subcutaneously administered 1α, 25-dihydroxyvitamin D 5 times a week 3 or Compound No. 22 for 6 weeks. After the last administration, 24-hour urine was sampled and blood was collected under ether anesthesia. After euthanizing the animal, remove the lumbar spine.
[0118] Lumbar bone mineral density at the third lumbar vertebra was measured with a dual X-ray bone mineral con...
Embodiment 3
[0124] Compound No. 22 has an affinity for vitamin D receptors of 1α, 25-dihydroxyvitamin D 3 0.8 times. Example 3: Compound No. 22 and 1α-hydroxyvitamin D in osteoporosis model rats 3 Effect on bone mass reduction (oral treatment) (A) Experimental method
[0125] Ovariectomy was performed on 8-week-old W-I female rats (Imamichi Institute of Animal Reproduction). Oral administration of 1α-hydroxyvitamin D at a daily dose of 0.1 μg / kg in a single dose or divided into two doses 5 times a week starting from the next day 3 Dosage, or Compound No. 22 was administered orally daily at a daily dose of 3 μg / kg for 5 weeks. After the last administration, 24-hour urine samples were taken, and blood samples were taken under ether anesthesia. After euthanizing the animal, remove the lumbar spine. Lumbar bone mineral density at the third lumbar vertebra was measured with a dual X-ray bone mineral content measuring device (DCS-600EX, ALOKA). Blood and urine calcium concentrations and u...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


