Supercharge Your Innovation With Domain-Expert AI Agents!

Method and compositions to reduce or eliminate transmission of transgene

A technology of gene and suicide gene, applied in the direction of genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve problems such as the difficulty of transgenic feed grass

Inactive Publication Date: 2003-06-25
YALE UNIV
View PDF51 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In general, specific difficulties may be encountered in the eventual release of transgenic forage grasses due to the fact that forage grasses are not highly domesticated, have weedy traits, and are highly outcrossed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and compositions to reduce or eliminate transmission of transgene
  • Method and compositions to reduce or eliminate transmission of transgene
  • Method and compositions to reduce or eliminate transmission of transgene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0253] Example 1. genetic construct

[0254] pYU904 - synthetic Ds element

[0255]Synthetic Ds elements were constructed by combining the Ac5' and 3' ends required for transposition. The 5' end of the activator element (Ac) was amplified from position 4312 to 4565 bp (GenBank accession number X01380) (SEQ ID NO: 3), while adding a Hind III cloning site to the 3' end of the fragment, and adding Hind III and Xho I sites to the 5' end. Primers P645 (gaattccctcgagtagggatgaaaacggtcggtaac) (SEQ ID NO: 4) and P646 (gaattcgaatatatgttttcatgtgtgat) (SEQ ID NO: 5) were used to amplify the 3' end of the Ac element from position 1 to 221 bp while adding another EcoRI and An XhoI restriction site and another EcoRI restriction site was added to the 5' end of the amplified fragment. These fragments were cloned individually into the vector pCR2.1-TOPO (Invitrogen).

[0256] Plasmid pYU890 contains the 5' fragment of the Ac element, and plasmid pYU892 contains the 3' fragment of the Ac...

Embodiment 2

[0350] Example 2. Prevent or eliminate the spread of GMOs

[0351] When hemizygous, elimination of transmission of the transgenic locus can be achieved by linking the gene of interest to a suicide gene under the control of a male- or female-specific promoter. This construct, termed "gametophytic suicide trait" (GST), induces cell death localized to GST-bearing microspores or megaspores, effectively reducing or eliminating transmission of the GST-linked gene of interest.

[0352] The gene carrying the particular trait that needs to be eliminated from the transgenic pollen (ie, the transgene of interest) can be placed anywhere as long as it is in physical proximity to the GST. Because the GST transgene complex is hemizygous, the GST transgene complex will be fully linked and there will be no concern that GST will recombine with other genes and / or transgenes.

[0353] The methods of the invention can be used in plant or seed transformation techniques that do not require cultiv...

Embodiment 3

[0370] Example 3. Enrichment for dispersed transposition events

[0371] By physically linking sterility traits to transposon sending sites and / or transposase sources, use "genetic sterility filtering" to highly enrich for disperse and / or stable transposition events without the use of chemical reagents and without the need for linkage-containing Progeny of transposition events and / or transposase sources are selected.

[0372] For example, when 50% male sterility is achieved, the remaining viable haploid genome does not inherit suicide genes and their associated transmission sites such as transposons due to normal homologous chromosome segregation, independent assortment, and meiotic recombination and / or elements of the transposase gene. Some of these living genomes will contain newly transposed elements, especially those with independent assortment or recombination from transposed sites and their associated suicide genes. Thus, "genetic sterility filtering" eliminates game...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Genetic constructs and methods are disclosed for the production, maintenance and control of transgenes in transgenic eukaryotic organisms that undergo meiosis in which pollen or sperm can be outcrossed; this includes: transgenic animals, plant cells, plant tissues and whole plants. More specifically, this invention relates to the control of transgene transmission by male and / or female gametes or gametophytes using a gametophytic sterility trait (GST). The genetic constructs and methodologies of the present invention provide the ability to control the undesired spread of transgenes. In addition, this invention also provides the tools and methodologies to enrich a plant or other eukaryotic genome for dispersed and / or stable transposition events.

Description

[0001] Cross-reference to related applications [0002] This application claims priority to provisional application 60 / 185,524, filed February 28, 2000, which is hereby incorporated by reference in its entirety. [0003] Claims of Rights to Inventions Made Through Federally Sponsored Research [0004] This invention was made in part with Government support under Grant Nos. NIH GM R01 GM38148 and NSF 61-2558. field of invention [0005] The present invention generally relates to the production, maintenance and control of transgenes in transgenic eukaryotic organisms that undergo meiosis and in which pollen or sperm can outcross; such organisms include: transgenic animals, plant cells, plant tissues and whole plants. More specifically, the invention relates to the control of transgene transmission by male and / or female gametes or gametophytes. The genetic constructs and methodologies of the present invention provide the ability to control the undesired spread of transgenes. I...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01H5/00C12N5/10C12N15/09C12N15/55C12N15/82
CPCC12N15/8289C12N15/829C12N15/8241C12N15/11
Inventor 斯蒂芬·L·德拉波塔玛丽亚·A·莫雷诺
Owner YALE UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More