Method and compositions to reduce or eliminate transmission of transgene
A technology of gene and suicide gene, applied in the direction of genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve problems such as the difficulty of transgenic feed grass
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0253] Example 1. genetic construct
[0254] pYU904 - synthetic Ds element
[0255]Synthetic Ds elements were constructed by combining the Ac5' and 3' ends required for transposition. The 5' end of the activator element (Ac) was amplified from position 4312 to 4565 bp (GenBank accession number X01380) (SEQ ID NO: 3), while adding a Hind III cloning site to the 3' end of the fragment, and adding Hind III and Xho I sites to the 5' end. Primers P645 (gaattccctcgagtagggatgaaaacggtcggtaac) (SEQ ID NO: 4) and P646 (gaattcgaatatatgttttcatgtgtgat) (SEQ ID NO: 5) were used to amplify the 3' end of the Ac element from position 1 to 221 bp while adding another EcoRI and An XhoI restriction site and another EcoRI restriction site was added to the 5' end of the amplified fragment. These fragments were cloned individually into the vector pCR2.1-TOPO (Invitrogen).
[0256] Plasmid pYU890 contains the 5' fragment of the Ac element, and plasmid pYU892 contains the 3' fragment of the Ac...
Embodiment 2
[0350] Example 2. Prevent or eliminate the spread of GMOs
[0351] When hemizygous, elimination of transmission of the transgenic locus can be achieved by linking the gene of interest to a suicide gene under the control of a male- or female-specific promoter. This construct, termed "gametophytic suicide trait" (GST), induces cell death localized to GST-bearing microspores or megaspores, effectively reducing or eliminating transmission of the GST-linked gene of interest.
[0352] The gene carrying the particular trait that needs to be eliminated from the transgenic pollen (ie, the transgene of interest) can be placed anywhere as long as it is in physical proximity to the GST. Because the GST transgene complex is hemizygous, the GST transgene complex will be fully linked and there will be no concern that GST will recombine with other genes and / or transgenes.
[0353] The methods of the invention can be used in plant or seed transformation techniques that do not require cultiv...
Embodiment 3
[0370] Example 3. Enrichment for dispersed transposition events
[0371] By physically linking sterility traits to transposon sending sites and / or transposase sources, use "genetic sterility filtering" to highly enrich for disperse and / or stable transposition events without the use of chemical reagents and without the need for linkage-containing Progeny of transposition events and / or transposase sources are selected.
[0372] For example, when 50% male sterility is achieved, the remaining viable haploid genome does not inherit suicide genes and their associated transmission sites such as transposons due to normal homologous chromosome segregation, independent assortment, and meiotic recombination and / or elements of the transposase gene. Some of these living genomes will contain newly transposed elements, especially those with independent assortment or recombination from transposed sites and their associated suicide genes. Thus, "genetic sterility filtering" eliminates game...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap