Anti-CD40 monoclonal antibody

An antibody, CD95 technology, applied in the direction of antibodies, antibody mimics/stents, anti-tumor drugs, etc.

Inactive Publication Date: 2004-08-18
KYOWA HAKKO KIRIN CO LTD
View PDF5 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In particular, there is a risk that the antibody becomes an agonistic antibody

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-CD40 monoclonal antibody
  • Anti-CD40 monoclonal antibody
  • Anti-CD40 monoclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0119] The preparation of embodiment 1 antigen

[0120] (1) cell

[0121] EL-4 cells are an established T cell line derived from mice and are readily available (ATCC: TIB-39). Ramos B cells (ATCC No.: CRL-1596) and mouse anti-CD40 antibody-producing hybridomas G28-5 (HB-9110) and 5D12 (HB-11339) were purchased from ATCC.

[0122] (2) Expression and purification of antigen

[0123] Using human CD40 cDNA (Genbank accession number: NM_001250) as a template, and the following primers, the extracellular region was amplified by PCR under the conditions of 20 cycles of 95°C for 5 seconds, 55°C for 30 seconds and 72°C for 30 seconds.

[0124] Primer 1: 5'-CCCAGATCTG TCCATCCAGA ACCACCCACTGCATGCAGAG-3' (SEQ ID NO: 1)

[0125] Primer 2: 5'-ACAAGATCTG GGCTCTACGT ATCTCAGCCGATCCTGGGGA C-3' (SEQ ID NO: 2)

[0126]The amplified cDNA was inserted before the melittin signal sequence and before the human IgGl-derived FC or mouse-derived FC region of the pFastBac vector (Gibco BRL). For prod...

Embodiment 2

[0127] Embodiment 2 is used for the generation of the mouse of immunization

[0128] Mice used for immunization have a genetic background that is homozygous for endogenous Ig heavy chains and kappa light chains, while mice contain a chromosome 14 fragment (SC20) containing the human Ig heavy chain locus, and human Ig kappa Strand transgene (Kco5). These mice were produced by crossing A-line mice with human Ig heavy chain genes and B-line mice with human Ig kappa chain transgenes. Line A mice are homozygous for disrupted endogenous Ig heavy chains and kappa light chains, contain a fragment of chromosome 14 (SC20), and can be passed on to offspring, as described above in the report by Tomizuku et al. (Tomizuka. et al., Proc Natl Acad Sci USA., 2000 Vol. 97: 722). Mice of line A were immunized to obtain the following hybridomas F2-103 and F5-77. In addition, mice of line B (transgenic mice) are homozygous for cleaved endogenous Ig heavy and kappa light chains and contain a hum...

Embodiment 3

[0130] Example 3 Preparation of human monoclonal antibody against human CD40

[0131] The monoclonal antibody in this example was prepared according to the general method described in the introduction of the experimental method of monoclonal antibody (Tamie ANDO et al., KODANSHA, 1991). The human CD40 used as the immunogen here was the human CD40 human FC prepared in Example 1 and the CD40-expressing EL-4-cells. Animals used for immunization herein were human antibody-producing mice producing the human immunoglobulin prepared in Example 2.

[0132] Immunize human antibody producing mice with 2 to 100 μg / CD40:hFc per mouse. Except for the first immunization, the antigen solution was mixed with an equal volume of Freund's incomplete adjuvant (Sigma) and injected subcutaneously into several separate sites. Immunizations are performed about 3 to 4 times every 10 days to 3 weeks. For the first immunization, Freund's incomplete adjuvant (Sigma) was used. Blood was collected from...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Antibodies or functional fragments thereof that have agonistic or antagonistic effects on CD40.

Description

technical field [0001] The present invention relates to an antibody or a functional fragment thereof that recognizes human CD40 antigen present on the surface of human B cells, dendritic cells (DC) and the like. Specifically, the present invention relates to an anti-human CD40 antibody or a functional fragment thereof which has a sufficient antagonistic effect on human CD40 antigen on the surface of dendritic cells (DC), and is expected to have a higher therapeutic effect than conventional anti-human CD40 antibodies. An agonistic anti-human CD40 antibody or a functional fragment thereof. Background technique [0002] 1. CD40 [0003] CD40 is an antigen with a molecular weight of 50 kDa present on the surface of the cell membrane. CD40 is expressed on B cells, dendritic cells (DC), certain types of cancer cells and thymic epithelial cells. CD40 is known to play an important role in the proliferation and differentiation of B cells and DCs. CD40 has been identified as an an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61P7/00A61P35/00A61P37/04A61P37/06A61P37/08C07K16/28C12N15/13C12P21/08
CPCC07K2319/00C07K2317/21C07K2316/95A61K2039/505C07K16/2878C07K2319/30C07K2316/96A61P7/00A61P7/04A61P35/00A61P37/02A61P37/04A61P37/06A61P37/08C07K2317/73C07K2317/74C07K2317/75C07K2317/76
Inventor三箇山俊文吉田均W·R·福斯陈兴捷高桥信明
OwnerKYOWA HAKKO KIRIN CO LTD