Indirect method of enzyme-linked immunosorbent assay for diagnosing antibody of hog cholera
A swine fever antibody and swine fever virus technology, which is applied in measurement devices, instruments, scientific instruments, etc., can solve the problems of difficulty in meeting swine fever diagnosis and immune detection, limited production of swine fever antigens, and high cost, and achieves low cost and production. The effect of short cycle and short time-consuming
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0010] a) Extraction of viral RNA:
[0011] Rabbit spleen tissue obtained from the China Veterinary Drug Control Institute was used to extract the total RNA kit from Boda Company according to the instructions.
[0012] b) reverse transcription:
[0013] Extracted total RNA 12 μL, downstream primer (5′CTGCCAACCGCCGTCTATCTT3′) 1 μL, preheated at 65°C for 10 minutes, ice-bathed for 5 minutes, then added 5 times reverse transcription buffer 4 μL, dNTP 2 μL, AMV 1 μL, total volume 20 μL, 42°C for 1 Hour.
[0014] c) PCR and nPCR amplification of target gene E 2 :
[0015] Take 5 μL of reverse transcription product, 5 μL of 10-fold PCR buffer, MgCl 2 3 μL, 4 μL of dNTP, 1 μL of each primer (upstream primer 5′TGTATTGACCAGACTGG3′, downstream primer 5′CTGCCAACCGCCGTCTATCTT3′), 0.5 μL Taq enzyme, and add water to 50 μL for amplification. The reaction conditions were 95°C, 50s; 48°C, 60s; 72°C, 120s, a total of 35 cycles, 72°C extension for 10min. nPCR (nested PCR): Take 1 μL of t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 