Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

New type mutant of heatlabile enterotoxin from bacteria coli, and preparation method

A heat-resistant enterotoxin and Escherichia coli technology, which is applied in the fields of botany equipment and methods, biochemical equipment and methods, chemical instruments and methods, etc., can solve the problems of low expression efficiency and unfavorable large-scale production, etc.

Inactive Publication Date: 2005-11-16
ARMY MEDICAL UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention aims at the problem that the existing LT expression efficiency is not high, which is not conducive to large-scale production as a mucosal immune adjuvant. Its primary purpose is to construct a new mutant of Escherichia coli heat-labile enterotoxin and improve the expression efficiency of LT

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New type mutant of heatlabile enterotoxin from bacteria coli, and preparation method
  • New type mutant of heatlabile enterotoxin from bacteria coli, and preparation method
  • New type mutant of heatlabile enterotoxin from bacteria coli, and preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0103] Example 1: Construction of a novel Escherichia coli heat-labile enterotoxin mutant

[0104] 1. Cloning the heat-labile enterotoxin gene of wild Escherichia coli:

[0105] (1) Using an improved genome extraction method to extract the plasmid carrying the LT gene from wild-type toxigenic Escherichia coli [Feng Qiang, Zou Quanming, Cai Shaoxi, etc. New method for the extraction of LT plasmids and the construction and sequence analysis of the non-toxic mutant LTS63K Journal of Immunology, 2002, 18(5): 385-388]

[0106] (2) The following primers were designed according to the Escherichia coli heat-labile enterotoxin gene sequence published by GenBank: P1: GGAATTCCCATATGAAAAATATAAC, P2: TAGGATCCTCCTAGCATTAGACAT.

[0107] (3) The lt gene was amplified from the plasmid encoding the LT gene by PCR method, and the gene was cloned into pMD18-T. 2. The first modification of the heat-labile enterotoxin gene of wild-type Escherichia coli:

[0108] In order to insert the Escherichi...

Embodiment 2

[0113] Implementation Example 2: Expression of novel Escherichia coli heat-labile enterotoxin mutants

[0114] A single colony of E.coli BL21(DE3) newly transformed with the recombinant plasmid was cultured in a test tube containing 4 mL of LB medium for 8 hours. Inoculate 500mL LB medium with 50μL bacterial solution and continue to cultivate in the flask for 8h to A 600nm ≈1.5. At the same time, the bacterial plasmid in the test tube was identified, and 500 mL of the seed bacteria with the correct plasmid was used for inoculation. The seed bacteria were inoculated in 5L of modified M9-CAA medium, and the antibiotic concentration was Amp 100 μg / mL. After fermenting in BIOSTAT 10L self-controlled fermenter for 3 hours, 2L of feed was added, and the ingredients of feed were: 20% glucose, 8% tryptone, and 8% yeast extract. A 600nm At ≈30, add IPTG to a final concentration of 0.5mmol / L for induction. After 5 hours of induction, the bacteria were harvested by centrifugation [F...

Embodiment 3

[0115] Implementation Example 3: Purification and preservation of recombinant LT and recombinant LTDITH

[0116]Resuspend the wet bacteria collected by centrifugation with 10 times the volume of TEAN (pH7.3) buffer, break the bacteria three times with a high-pressure homogenizer at 70 MPa, check the bacteria-breaking effect with an oil microscope; collect the cell disruption solution by centrifugation at 16000g×30min at 4°C The supernatant was centrifuged at 16000g×30min at 4°C to discard the precipitate; the supernatant was passed through a 0.22 μm filter membrane and the filtrate was collected; the Immobilized D(+)-galactose affinity column ( Pierce, USA), Tuning A 280nm baseline. The ultrafiltered supernatant was applied to the column at a flow rate of 1.5 mL / min. After loading 200mL of sample, use TEAN (pH7.3) buffer to wash the impurities to A 280nm Return to baseline; use 0.3mol / L galactose (Galactose) elution buffer to elute the LT or LTDITH bound to the column, coll...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A novel mutant of the thermolabile enterotoxin of colibacillus for preparing anti-enterotoxin vaccine is prepared from the gene coding the thermolabile enterotoxin of wild colibacillus by recombining DNA. It features that the amino acid residues at the sites of No.229, 230, 232 and 233 of the protein are changed from Glu, Val, Ile and Tyr respectively to Asp, Ile, Thr and His.

Description

technical field [0001] The invention relates to a novel mutant of Escherichia coli heat-labile enterotoxin, which can be used as an immunogenic component in vaccines, such as a vaccine against diarrhea caused by enterotoxin or as an adjuvant for other vaccines. The mutant can be obtained from the gene encoding the heat-labile enterotoxin of wild-type Escherichia coli by recombinant DNA technology. Background technique [0002] The vast majority of infectious diseases enter the human body through the mucosal route. For the treatment of infectious diseases, vaccines are obviously a more convenient and economical means. Most of the existing vaccines are still inoculated by injection. Although immunization through injection can greatly increase the level of specific antibodies in the blood, the level of local mucosal antibodies—the first barrier against pathogen invasion—is relatively low. The protective effect on the body will inevitably be greatly reduced: in addition, uncle...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/31
Inventor 邹全明冯强杨珺罗萍张卫军毛旭虎
Owner ARMY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com