Method for detecting lamivudine drug-resistant HBV DNA and its kit
A technology of lamivudine and kit, which is applied in the field of detection of hepatitis B virus lamivudine resistance, and can solve the problems of low detection rate of drug-resistant and sensitive strains, unstable reaction system, and high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0084] Design and prepare primers and probe sequences (designed for HBV DNA P gene related sequences, GeneBank sequence number is AF536524, the same below):
[0085] Primer 1 (upstream primer) 5' TGTATTCCCATCCCATCATCCT 3',
[0086] Primer 2 (HBV detection primer 1) 5'ATGTTGTACAGATTTGGTCCC 3',
[0087] Primer 3 (HBV detection primer 2) 5'TTGGCTTCCAGTACCACATCATC 3',
[0088] Primer 4 (YIDD detection primer 1) 5' CCCCAGTACCACATCATCA 3',
[0089] Primer 5 (YIDD detection primer 2) 5' CCCAGAACCACATCATCA 3',
[0090] Primer 6 (YVDD detection primer 1) 5' CCCAGTACCACATCATTCAC 3',
[0091] Primer 7 (YVDD detection primer 2) 5' CCCAGAACCACATCATTCAC 3',
[0092] Probe 1 5'TCCTATGGGAGTGGGCCTCAG 3',
[0093]The fluorescent labels of probe 1 are: fluorophores FAM, TET, JOE, Cy3, Cy5, Cy5.5, Fluorescein, Rhodamine, Rhodamine Red, Rhodamine Green, Rhodamine 6G, Oregon Green 488, Oregon Green 500, Oregon Green 514 , Texas Red, TAMRA, Inosine, HEX, FITC, Acridine orange, or ROX or a comb...
Embodiment 2
[0118] Design and prepare primers and probe sequences:
[0119] Primer 1 (upstream primer) 5' TGTATTCCCATCCCATCATCCT 3',
[0120] Primer 2 (HBV detection primer 1) 5'ATGTTGTACAGATTTGGTCCC 3',
[0121] Probe 15'TCCTATGGGAGTGGGCCTCAG 3',
[0122] Probe 3(I) 5'ACCACATCATCAATATAACTGAAAGCC 3',
[0123] Probe 4(V) 5'ACCACATCATCCACATAACTGAAAGC 3',
[0124] The fluorescent labels of probes 1, 3, and 4 can be respectively: fluorescent light-emitting groups FAM, TET, JOE, Cy3, Cy5, Cy5.5, Fluorescein, Rhodamine, Rhodamine Red, Rhodamine Green, Rhodamine 6G, OregonGreen 488, Oregon Green 500, Oregon Green 514, Texas Red, TAMRA, Inosine, HEX, FITC, Acridine orange, or ROX or a combination thereof; the fluorescence quenching group is DABCYL, DABSYL, TAMRA, BHQ-1, BHQ-2 or One or a combination of BHQ-3.
[0125] Hepatitis B virus (HBV) lamivudine resistance fluorescence PCR detection kit composition
[0126] Composition (10 servings / box) Volume
[0127] Extract A 500μl x 1 tube
[0...
Embodiment 3
[0151] The above two embodiments use the same data statistical methods, result judgment and quality control standards: Ct-c: Ct value of C detection tube; Ct-v: Ct value of V mutation detection tube; Ct-i: I mutation detection tube ΔCt-i=Ct-i-Ct-c; ΔCt-v=Ct-v-Ct-c.
[0152] Quality control standard
[0153] control
[0154] result judgment
[0155] Experimental calculation results
[0156] The HBV virus in the patient's serum is often a symbiosis of YMDD wild-type and mutant. When the Ct value (Ct-i or Ct-v) of the mutation site detection tube is 40, it indicates that there is no corresponding mutant virus in the sample or its content is lower than the sensitivity of the kit. When the mutation site detection tube Ct≤35, for the case of 3.5<ΔCt<4.5, the ratio of the total HBV number to the corresponding mutant strain is about 10:1; for the case of 6.5<ΔCt<8, the total HBV number and the corresponding mutation The ratio of strains was about 100:1; for th...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com