Method for detecting lamivudine drug-resistant HBV DNA and its kit

A technology of lamivudine and kit, which is applied in the field of detection of hepatitis B virus lamivudine resistance, and can solve the problems of low detection rate of drug-resistant and sensitive strains, unstable reaction system, and high cost

Inactive Publication Date: 2005-12-21
SHANGHAI XINGYAO MED TECH DEV CO LTD
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0012] The object of the present invention is to provide a kind of method and test kit for detecting lamivudine drug-resistant HBV DNA, to overcome the low detection rate of drug-resistant strains and sensitive strains in the prior art, high cost and poor reaction system stable defect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] Design and prepare primers and probe sequences (designed for HBV DNA P gene related sequences, GeneBank sequence number is AF536524, the same below):

[0085] Primer 1 (upstream primer) 5' TGTATTCCCATCCCATCATCCT 3',

[0086] Primer 2 (HBV detection primer 1) 5'ATGTTGTACAGATTTGGTCCC 3',

[0087] Primer 3 (HBV detection primer 2) 5'TTGGCTTCCAGTACCACATCATC 3',

[0088] Primer 4 (YIDD detection primer 1) 5' CCCCAGTACCACATCATCA 3',

[0089] Primer 5 (YIDD detection primer 2) 5' CCCAGAACCACATCATCA 3',

[0090] Primer 6 (YVDD detection primer 1) 5' CCCAGTACCACATCATTCAC 3',

[0091] Primer 7 (YVDD detection primer 2) 5' CCCAGAACCACATCATTCAC 3',

[0092] Probe 1 5'TCCTATGGGAGTGGGCCTCAG 3',

[0093]The fluorescent labels of probe 1 are: fluorophores FAM, TET, JOE, Cy3, Cy5, Cy5.5, Fluorescein, Rhodamine, Rhodamine Red, Rhodamine Green, Rhodamine 6G, Oregon Green 488, Oregon Green 500, Oregon Green 514 , Texas Red, TAMRA, Inosine, HEX, FITC, Acridine orange, or ROX or a comb...

Embodiment 2

[0118] Design and prepare primers and probe sequences:

[0119] Primer 1 (upstream primer) 5' TGTATTCCCATCCCATCATCCT 3',

[0120] Primer 2 (HBV detection primer 1) 5'ATGTTGTACAGATTTGGTCCC 3',

[0121] Probe 15'TCCTATGGGAGTGGGCCTCAG 3',

[0122] Probe 3(I) 5'ACCACATCATCAATATAACTGAAAGCC 3',

[0123] Probe 4(V) 5'ACCACATCATCCACATAACTGAAAGC 3',

[0124] The fluorescent labels of probes 1, 3, and 4 can be respectively: fluorescent light-emitting groups FAM, TET, JOE, Cy3, Cy5, Cy5.5, Fluorescein, Rhodamine, Rhodamine Red, Rhodamine Green, Rhodamine 6G, OregonGreen 488, Oregon Green 500, Oregon Green 514, Texas Red, TAMRA, Inosine, HEX, FITC, Acridine orange, or ROX or a combination thereof; the fluorescence quenching group is DABCYL, DABSYL, TAMRA, BHQ-1, BHQ-2 or One or a combination of BHQ-3.

[0125] Hepatitis B virus (HBV) lamivudine resistance fluorescence PCR detection kit composition

[0126] Composition (10 servings / box) Volume

[0127] Extract A 500μl x 1 tube

[0...

Embodiment 3

[0151] The above two embodiments use the same data statistical methods, result judgment and quality control standards: Ct-c: Ct value of C detection tube; Ct-v: Ct value of V mutation detection tube; Ct-i: I mutation detection tube ΔCt-i=Ct-i-Ct-c; ΔCt-v=Ct-v-Ct-c.

[0152] Quality control standard

[0153] control

[0154] result judgment

[0155] Experimental calculation results

[0156] The HBV virus in the patient's serum is often a symbiosis of YMDD wild-type and mutant. When the Ct value (Ct-i or Ct-v) of the mutation site detection tube is 40, it indicates that there is no corresponding mutant virus in the sample or its content is lower than the sensitivity of the kit. When the mutation site detection tube Ct≤35, for the case of 3.5<ΔCt<4.5, the ratio of the total HBV number to the corresponding mutant strain is about 10:1; for the case of 6.5<ΔCt<8, the total HBV number and the corresponding mutation The ratio of strains was about 100:1; for th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention involves the method of measuring Lamivudine's medicine-resisting HBV DNA and reagent box. Correlated with two kinds of main sudden change genes (YMDD sudden change is for YVDD and YIDD) design peculiar sudden change measure primer and virus peculiar measure primer and the public related probe, or design peculiar sudden change measure probe and virus peculiar measuring probe to conduct the real-time measure to the same sample respectively in three PCR tubes through the same PCR procedure. According to the D value of the Ct value in reaction tube 1, V reaction tube with the Ct value of the C reaction tube (í¸Ctú¡i=Ctú¡iú¡Ctú¡cú¼í¸Ctú¡v=Ctú¡vú¡Ctú¡c) to judge the YVDD and YIDD medicine-resisting sudden change situation of HBV in clinical sample. Advantages: stable reagent box performance, high sensitivity and so on.

Description

technical field [0001] The invention relates to a method for detecting HBV DNA and a kit thereof, in particular to the detection of the drug resistance of hepatitis B virus lamivudine by using fluorescent labeled probes and specific primers. Background technique [0002] Hepatitis B virus (HBV) is prevalent all over the world. It is estimated that 2 billion people are infected worldwide, of which 350 million are chronically infected, and my country accounts for about half of them. About 1 million people die from HBV infection every year. This infection can eventually develop into liver cirrhosis and liver cancer, which is currently the ninth leading cause of death in human diseases announced by WHO. [0003] The current treatments for HBV infection mainly include interferon and lamivudine. Interferon has a long course of treatment and a low overall response rate. Only 20% to 30% of hepatitis B virus e antigen (HBeAg) disappears in non-selected patients. The curative effect ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
Inventor何剑军周煜夏懿
OwnerSHANGHAI XINGYAO MED TECH DEV CO LTD