Endogenous reference used for detecting human body pathogen and its application
An endogenous, pathogenic technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of lack of endogenous internal reference
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0154] Whole Blood, Serum, and Plasma Sample Results Comparison
[0155]Take 50 μl of serum, plasma, and whole blood samples from the same source, positive control, and negative control in the kit, add 50 μl nucleic acid extraction solution A respectively, shake and mix for 10 seconds, centrifuge at 12,000 rpm for 10 minutes, and discard the supernatant; Add 50 μl of nucleic acid extraction solution B to the precipitate (must be fully mixed when using nucleic acid extraction solution B, add the particles and liquid together to the precipitation, and the amount of particles should be within 15%), shake and mix for 10 seconds, 100°C Boiling water bath for 10 minutes, centrifuged at 12,000rpm for 2 minutes.
[0156] Specimen source
[0157] The results showed that in the same extraction method, the concentrations of the human endogenous control gene DNA contained in the three samples were as follows: whole blood>plasma>serum.
Embodiment 2
[0159] Effect of different magnesium ion concentrations in the system on the results
[0160]
[0161] The above results show that the magnesium ion concentration of 2.0-10.0mM can be used, and the magnesium ion concentration of 3.5mM is the most suitable.
Embodiment 3
[0163] Detection of HBV
[0164] The hepatitis B virus particles in serum samples were concentrated by polyethylene glycol (PEG) precipitation method, denatured virus particles were lysed by alkali, and impurities were adsorbed by Chelex to obtain DNA.
[0165] After extraction, the sample is added to the reaction system. The system components are shown above. The system contains HBV primers and probes, internal reference primers and probes.
[0166] HBV primer and probe sequences are:
[0167] Upstream primer 5 TGCCAAGTGTTTGCTGA (SEQ ID NO: 14)
[0168] Downstream primer 5 AAGAAGGGGACGGTAGA (SEQ ID NO: 15)
[0169] Probe FAM-5 ACGCAACCCCCACTGGCTGGGG-TAMRA (SEQ ID NO: 16)
[0170] The internal reference primers and probe sequences are:
[0171] Upstream primer 4 TCCAACTGTTCATCGGCTGAGA (SEQ ID NO: 11)
[0172] Downstream primer 4 TACGCCCGAGCAGATGCCAACA (SEQ ID NO: 12)
[0173] Probe 4 FAM-CATGCTAAGGCGAGGATGAAAC-TAMRA (SEQ ID NO: 13)
[0174] Use ROTOGENE for amplificatio...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More