Unlock instant, AI-driven research and patent intelligence for your innovation.

Endogenous reference used for detecting human body pathogen and its application

An endogenous, pathogenic technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of lack of endogenous internal reference

Inactive Publication Date: 2006-06-14
SHANGHAI XINGYAO MED TECH DEV CO LTD
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, there is still a lack of satisfactory endogenous internal reference in the field so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0154] Whole Blood, Serum, and Plasma Sample Results Comparison

[0155]Take 50 μl of serum, plasma, and whole blood samples from the same source, positive control, and negative control in the kit, add 50 μl nucleic acid extraction solution A respectively, shake and mix for 10 seconds, centrifuge at 12,000 rpm for 10 minutes, and discard the supernatant; Add 50 μl of nucleic acid extraction solution B to the precipitate (must be fully mixed when using nucleic acid extraction solution B, add the particles and liquid together to the precipitation, and the amount of particles should be within 15%), shake and mix for 10 seconds, 100°C Boiling water bath for 10 minutes, centrifuged at 12,000rpm for 2 minutes.

[0156] Specimen source

[0157] The results showed that in the same extraction method, the concentrations of the human endogenous control gene DNA contained in the three samples were as follows: whole blood>plasma>serum.

Embodiment 2

[0159] Effect of different magnesium ion concentrations in the system on the results

[0160]

[0161] The above results show that the magnesium ion concentration of 2.0-10.0mM can be used, and the magnesium ion concentration of 3.5mM is the most suitable.

Embodiment 3

[0163] Detection of HBV

[0164] The hepatitis B virus particles in serum samples were concentrated by polyethylene glycol (PEG) precipitation method, denatured virus particles were lysed by alkali, and impurities were adsorbed by Chelex to obtain DNA.

[0165] After extraction, the sample is added to the reaction system. The system components are shown above. The system contains HBV primers and probes, internal reference primers and probes.

[0166] HBV primer and probe sequences are:

[0167] Upstream primer 5 TGCCAAGTGTTTGCTGA (SEQ ID NO: 14)

[0168] Downstream primer 5 AAGAAGGGGACGGTAGA (SEQ ID NO: 15)

[0169] Probe FAM-5 ACGCAACCCCCACTGGCTGGGG-TAMRA (SEQ ID NO: 16)

[0170] The internal reference primers and probe sequences are:

[0171] Upstream primer 4 TCCAACTGTTCATCGGCTGAGA (SEQ ID NO: 11)

[0172] Downstream primer 4 TACGCCCGAGCAGATGCCAACA (SEQ ID NO: 12)

[0173] Probe 4 FAM-CATGCTAAGGCGAGGATGAAAC-TAMRA (SEQ ID NO: 13)

[0174] Use ROTOGENE for amplificatio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an examination human body pathogen endogenous reference and its application. And it offers biological sample identity system amplification human body pathogen DNA and body endogenous reference gene DNA method and its corresponding nucleic acid examination kit. The endogenous reference can use as monitoring reference in overall process to effectively reduce the examination false negative probability.

Description

technical field [0001] The invention relates to a nucleic acid detection method, in particular to an endogenous reference for detecting human pathogens and its application. It also provides a method for amplifying human pathogen DNA and human endogenous control gene DNA from biological samples in the same system, and a corresponding nucleic acid detection kit. Background technique [0002] Virus detection is a leap from biochemical methods to nucleic acid methods. Since the invention of the PCR method, nucleic acid detection has developed by leaps and bounds, and various detection technologies have emerged in combination with other technologies. [0003] The development of PCR detection technology is roughly as follows: At the beginning, agarose gel electrophoresis was used to detect the fluorescence of EB bound to the double strand of nucleic acid under ultraviolet irradiation. The disadvantage is that the system is open and easy to pollute, and EB and ultraviolet are harm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 夏懿周煜徐晓青
Owner SHANGHAI XINGYAO MED TECH DEV CO LTD