Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Hybrid protein of p53 protein epitope(SQAMDDLMLS) and filobactivirus gene 8 protein and application thereof

A filamentous phage and hybrid protein technology, applied in the field of DNA recombination, can solve the problems of lack of tumor diagnosis, prevention and treatment

Inactive Publication Date: 2006-07-19
NORTHEAST NORMAL UNIVERSITY
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is still a lack of drugs that cannot effectively diagnose, prevent and treat tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] 1. Synthesis of epitope gene:

[0040] The epitope gene fragment (GGAGGGTTCTCAAGCTATGGATGATTTAATGTTATTCTCCATCGATGGAGATAACATTAAATCATCCATAGCTTGAGAACCCTCCGCGC) was synthesized using a DNA synthesizer from a commercial biotech company.

[0041] 2. Construction of recombinant vector

[0042] 1) Take 5 μg of pfd88 plasmid, add 1-2 μL of SacII enzyme, and then add buffer and sterile water to a total volume of 200 μl. Incubate at 37°C for 24 hours. After digestion, the plasmid DNA was extracted by conventional methods. After extraction, DNA was precipitated with ammonium acetate and two volumes of ethanol, and dissolved in 50 μL TE solution.

[0043] 2) Treat the plasmid DNA that has been digested by the first restriction endonuclease BstBI with the same method as above.

[0044] 3) After double digestion, perform agarose gel electrophoresis to determine the carrier concentration.

[0045] 4) The carrier and the artificially synthesized exogenous DNA fragments are mixed at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention belongs to the DNA recombination field in bioengineering. Wherein, with the recombination technique, inserting the gene fragment of B cell epitope composed by 37-46 peptide fragments on N-end of P53 protein into the carrier integrated with main coat protein gene of filamentous phage to form the new recombinant plasmid; in host, secreting the epitope gene product out of the cell to assemble in coat protein and form heterozygous protein that can be used as a antigen to detect antibody in clinical tumor patient serum (such as, gastric cancer, liver cancer, breast cancer and lung cancer).

Description

technical field [0001] The invention belongs to the technical field of DNA recombination in bioengineering. Background technique [0002] Tumor is the world's second "killer" disease after cardiovascular disease. By the end of 1999, the total number of cancer patients in the world has exceeded 40 million. In my country, 1.3 million people die of cancer every year. At present, there is still a lack of drugs that cannot effectively diagnose, prevent and treat tumors. [0003] p53 is a tumor suppressor gene, its protein plays an important regulatory role in maintaining normal cell division and growth, but once a mutation occurs, the half-life of the mutant protein is prolonged, losing its tumor suppressor effect, and accumulating in cells stimulates the immune system to produce corresponding antibodies . The gene fragment of the B cell epitope composed of the N-terminal 20-25 peptide segment and the 37-46 peptide segment is inserted into the vector integrated with the main ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/12C12N15/62G01N33/68
Inventor 王丽华攀玉高瑞娟
Owner NORTHEAST NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products