Hybrid protein of p53 protein epitope(SQAMDDLMLS) and filobactivirus gene 8 protein and application thereof
A filamentous phage and hybrid protein technology, applied in the field of DNA recombination, can solve the problems of lack of tumor diagnosis, prevention and treatment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0039] 1. Synthesis of epitope gene:
[0040] The epitope gene fragment (GGAGGGTTCTCAAGCTATGGATGATTTAATGTTATTCTCCATCGATGGAGATAACATTAAATCATCCATAGCTTGAGAACCCTCCGCGC) was synthesized using a DNA synthesizer from a commercial biotech company.
[0041] 2. Construction of recombinant vector
[0042] 1) Take 5 μg of pfd88 plasmid, add 1-2 μL of SacII enzyme, and then add buffer and sterile water to a total volume of 200 μl. Incubate at 37°C for 24 hours. After digestion, the plasmid DNA was extracted by conventional methods. After extraction, DNA was precipitated with ammonium acetate and two volumes of ethanol, and dissolved in 50 μL TE solution.
[0043] 2) Treat the plasmid DNA that has been digested by the first restriction endonuclease BstBI with the same method as above.
[0044] 3) After double digestion, perform agarose gel electrophoresis to determine the carrier concentration.
[0045] 4) The carrier and the artificially synthesized exogenous DNA fragments are mixed at...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com