Method for reforming high-virulent nuclear polyhedrosis virus of lepidoptera pest
A karyotype polyhedron and lepidopteran technology, applied in the biological field, can solve the problems of limited popularization and application, unsatisfactory control effect, long incubation period and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0019] Example NPV construction method containing the tea geometrid chitin synthase (CS) antisense gene sequence:
[0020] 1) Take about 100 mg of 1 third-instar tea geometrid larvae, extract total RNA with Trizol (Invitrogen Company) reagent, detect RNA quality by electrophoresis, and analyze RNA concentration with GENQUENT. Refer to the reagent and instrument instructions for specific operations;
[0021] 2) Synthesize the first strand of cDNA of tea geometrid larvae with the MMLV first strand cDNA synthesis kit, and refer to the kit instructions for specific operations;
[0022] 3) Perform RT-PCR with the following primer pairs containing restriction sites, and the PCR conditions are shown in Table 1;
[0023] L 5'AA TTCGAATACGCCATCGGCCATTGG (The underlined part is the Xba I restriction site)
[0024] R 5'AA CCAACGATCCTCGCCCTGATCGTACTG (the underlined part is the restriction site of BamH I)
[0025] PCR reaction system
The ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 