Rice EPSP synthase mutant and its coding gene, obtaining method and application

An EPSP synthase and mutant technology, which is applied in biochemical equipment and methods, enzymes, and the introduction of foreign genetic material using vectors, can solve the problems of inability to express, low efficiency, time-consuming and cost-consuming codon modification, and achieve high activity. Effect

Inactive Publication Date: 2006-08-02
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In addition, because the genes derived from bacteria and fungi cannot encode the unique transit peptide sequence of plant proteins, and EPSP synthase can only play its role when it is transported into the chloroplast, so it is necessary to artificially add a transit peptide sequence ( Della-cioppa G, Bauer SC, Klein BK, Shah DM, FraleyRT, Kishore GM (1986) Translocation of the precursor of 5-enolpyruvylshikimate3-phosphate synthase into chloroplasts of higher plants in vitro. Proc NatlAcad Sci USA 83: 6873-6877) ; At the same time, the codon preference of bacteria or fungi is very different from that of plants. Therefore, the efficiency of transforming genes derived from bacteria and fungi into plants is usually very low, or even impossible to express. Modification can be successfully expressed in transgenic plants, but codon modification is time-consuming and costly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice EPSP synthase mutant and its coding gene, obtaining method and application
  • Rice EPSP synthase mutant and its coding gene, obtaining method and application
  • Rice EPSP synthase mutant and its coding gene, obtaining method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1、5

[0045] Example 1, the acquisition and detection of 5-enolpyruvylshikimate-3-phosphate synthase mutant EPSPS-MP

[0046] 1. Cloning of rice EPSP synthase cDNA and construction of intermediate cloning vector pGEP

[0047] Primers were designed according to the complete cDNA sequence (Genbank AF413081) of rice EPSP synthase in Genbank, and the primer sequences were as follows:

[0048] Primer 1: 5'TTCTCGTCGCGGAAGCAGCT 3'

[0049] Primer 2: 5'CAACAGAACCTAGACCTCAC 3'

[0050] 1) Extract the total RNA from the leaves of rice variety Minghui 63, and then use it as a template to synthesize the cDNA of rice;

[0051] 2) Using the rice cDNA synthesized in step 1) as a template, under the guidance of primers 1 and 2, PCR amplifies the EPSP synthase gene. The PCR reaction system is: 2 μL of the rice cDNA obtained in step 1), EX-Taq DNA polymerase 1U (TaKaRa company), 5μL of 10×EX-Taq DNase buffer, 5μL of dNTPs (2.5umol / L), 10pmol of primer 1 and primer 2, and finally add ddH 2 O water...

Embodiment 2

[0082] Example 2. Tobacco Transformation Experiment of Glyphosate-resistant Mutants and Functional Analysis of Transgenic Plants

[0083] 1. Obtaining transgenic tobacco containing glyphosate-resistant mutants

[0084] 1) Construction of a dicotyledonous plant transformation vector: according to the cDNA sequence of rice EPSP synthase (Genbank AF413081), primers for amplifying the DNA fragment encoding the transit peptide part were synthesized, and the sequence was as follows:

[0085] Primer 9: 5'TCTAGAATGGCGGCGACCATG

[0086]Primer 10: 5'CAAGTACTGACTGCTGATGG

[0087] Using the aforementioned rice eDNA as a template, the PCR reaction conditions were carried out according to the instructions of the high-fidelity GC-rich dedicated LA Taq enzyme (TaKaRa) amplification system. ℃ insulation 10min. The PCR product was recovered by low-melting point agarose gel, and inserted into the clone vector pGSMT-easy vector (Promega Company). According to the operating procedure of Bio-Rad...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses one kind of 5-enolpyruvoyl shikimic acid-3-phosphosynthase mutant and its coding gene, obtaining method and application in culturing glyphosate resisting plant. The 5-enolpyruvoyl shikimic acid-3-phosphosynthase has the residue sequence as shown in SEQ ID No. 2, and will take important role in the culture of glyphosate resisting plant.

Description

technical field [0001] The present invention relates to a rice-derived 5-enolpyruvylshikimate-3-phosphate synthase (5-enolpyruvylshikimate 3-phosphate synthase, EPSP synthase) mutant and its coding gene, a method for obtaining the mutant and its use in Application in breeding glyphosate-resistant plants. Background technique [0002] Glyphosate is a systemic non-selective herbicide, and is currently the most widely used broad-spectrum herbicide, which can effectively control 76 of the 78 most harmful weeds in the world. It has the advantages of non-toxicity to animals, short soil residual period and easy degradation. Widely available commercial herbicide Roundup TM The main ingredient is glyphosate. Since the 1980s, people have been keen on cultivating glyphosate-resistant crops, and successfully obtained many glyphosate-resistant crops through genetic engineering technology. The planting of these crops not only makes the farming management in the field more concise and e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/00C12N15/52C12N15/63C07H21/00C12N15/09C12N15/70C12N15/82
Inventor朱祯周敏
OwnerINST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI