Rice EPSP synthase mutant and its coding gene, obtaining method and application
An EPSP synthase and mutant technology, which is applied in biochemical equipment and methods, enzymes, and the introduction of foreign genetic material using vectors, can solve the problems of inability to express, low efficiency, time-consuming and cost-consuming codon modification, and achieve high activity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1、5
[0045] Example 1, the acquisition and detection of 5-enolpyruvylshikimate-3-phosphate synthase mutant EPSPS-MP
[0046] 1. Cloning of rice EPSP synthase cDNA and construction of intermediate cloning vector pGEP
[0047] Primers were designed according to the complete cDNA sequence (Genbank AF413081) of rice EPSP synthase in Genbank, and the primer sequences were as follows:
[0048] Primer 1: 5'TTCTCGTCGCGGAAGCAGCT 3'
[0049] Primer 2: 5'CAACAGAACCTAGACCTCAC 3'
[0050] 1) Extract the total RNA from the leaves of rice variety Minghui 63, and then use it as a template to synthesize the cDNA of rice;
[0051] 2) Using the rice cDNA synthesized in step 1) as a template, under the guidance of primers 1 and 2, PCR amplifies the EPSP synthase gene. The PCR reaction system is: 2 μL of the rice cDNA obtained in step 1), EX-Taq DNA polymerase 1U (TaKaRa company), 5μL of 10×EX-Taq DNase buffer, 5μL of dNTPs (2.5umol / L), 10pmol of primer 1 and primer 2, and finally add ddH 2 O water...
Embodiment 2
[0082] Example 2. Tobacco Transformation Experiment of Glyphosate-resistant Mutants and Functional Analysis of Transgenic Plants
[0083] 1. Obtaining transgenic tobacco containing glyphosate-resistant mutants
[0084] 1) Construction of a dicotyledonous plant transformation vector: according to the cDNA sequence of rice EPSP synthase (Genbank AF413081), primers for amplifying the DNA fragment encoding the transit peptide part were synthesized, and the sequence was as follows:
[0085] Primer 9: 5'TCTAGAATGGCGGCGACCATG
[0086]Primer 10: 5'CAAGTACTGACTGCTGATGG
[0087] Using the aforementioned rice eDNA as a template, the PCR reaction conditions were carried out according to the instructions of the high-fidelity GC-rich dedicated LA Taq enzyme (TaKaRa) amplification system. ℃ insulation 10min. The PCR product was recovered by low-melting point agarose gel, and inserted into the clone vector pGSMT-easy vector (Promega Company). According to the operating procedure of Bio-Rad...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


