Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing highly-active thrombin inhibitor

A thrombin inhibitor, high activity technology, applied in the field of applied genetic engineering, can solve the problems of lack of natural hirudin source, limited yield, limited clinical application, etc., and achieve the effects of no immunogenicity, small molecular weight, and significant curative effect

Inactive Publication Date: 2006-10-04
龙铟 +1
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The scarcity of natural hirudin sources and limited yield limit its clinical application; in addition, there are many variants of hirudin, and previous research work can only recombine and express a certain hirudin variant at a time, and it is impossible to realize the expression of multiple hirudin variants. Variants undergo simultaneous rapid evolution to further improve the function of hirudin-encoded proteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing highly-active thrombin inhibitor
  • Method for preparing highly-active thrombin inhibitor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] 1. Synthesis of the target gene

[0021] (1) Design of hirudin gene and PCR primers

[0022] According to the amino acid sequences of hirudin HV1, HV2, and HV3, the coding sequences and PCR primer sequences of 3 genes were designed. The hirudin genes were divided into 8 single-stranded nucleotide fragments. The DNA synthesis was completed by Shanghai Sangong Bioengineering Company. The sequences of each gene and corresponding PCR primers are as follows:

[0023] ① HV1 gene sequence

[0024] 1 tatgcggcccagccggccgttgtttacactgactgtactgaatctggtcaaaacttgtgt

[0025] 61 ttgtgtgaaggttctaacgtttgtggtcaaggtaacaagtgtatcttgggttctgacggt

[0026] 121 gaaaagaaccaatgtgttactggtgaaggtactccaaagccacaatctcacaacgacggt

[0027] 181 gacttcgaagaaattccagaagaatacttgcaagcggccgcaggt

[0028] PCR forward primer: 5′-ta g cgg ccc agc cgg cc g ttg ttt aca ct(SfiI)

[0029] PCR reverse primer: 5′-act gcg gcc gc t tgc aag ta(NotI)

[0030] The 5' ends of the PCR forward primer and reverse prim...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a process for preparing high activity thrombin inhibitors, which comprises subjecting hirudin, the natural specific inhibitor of thrombin to DNA family restructuring, carrying out restructuring to hirudin HV1, HV2, HV3 genes, constructing reorganization library for hirudin bacteriophage display, using thrombin as coating antigen, subjecting bacteriophage reorganization library to three rounds of enriched elutriation including adsorption, elution and expansion, obtaining a plurality of bacteriophage monoclons with high affinity with thrombin through ELISA screening, carrying out pronucleus induced expression to these clones, finally detecting the antithrombogenic activity of the purification expression product.

Description

technical field [0001] The invention belongs to the application of genetic engineering technology, and relates to the random recombination of genes in vitro by using DNA family reorganization technology to increase the diversity of genes, combined with an efficient and fast screening system, to obtain expression products with better biological functions, and specifically relates to a high-efficiency Process for the preparation of active thrombin inhibitors. Background technique [0002] Nowadays, thrombotic cardiovascular and cerebrovascular diseases have become the enemy that threatens human health. It is a very urgent task to explore and study effective drugs to prevent and treat this disease. Anticoagulant and antiplatelet therapy is an important milestone in today's cardiovascular diseases. Traditional anticoagulant drugs, such as non-component heparin (UFH), low molecular weight heparin, acetone benzyl hydroxycoumarin, etc., have been used as plasma coagulation system i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/58C12N15/63A61P7/02
Inventor 龙铟刘家云刘莉王宗仁
Owner 龙铟
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com