Method for preparing highly-active thrombin inhibitor
A thrombin inhibitor, high activity technology, applied in the field of applied genetic engineering, can solve the problems of lack of natural hirudin source, limited yield, limited clinical application, etc., and achieve the effects of no immunogenicity, small molecular weight, and significant curative effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] 1. Synthesis of the target gene
[0021] (1) Design of hirudin gene and PCR primers
[0022] According to the amino acid sequences of hirudin HV1, HV2, and HV3, the coding sequences and PCR primer sequences of 3 genes were designed. The hirudin genes were divided into 8 single-stranded nucleotide fragments. The DNA synthesis was completed by Shanghai Sangong Bioengineering Company. The sequences of each gene and corresponding PCR primers are as follows:
[0023] ① HV1 gene sequence
[0024] 1 tatgcggcccagccggccgttgtttacactgactgtactgaatctggtcaaaacttgtgt
[0025] 61 ttgtgtgaaggttctaacgtttgtggtcaaggtaacaagtgtatcttgggttctgacggt
[0026] 121 gaaaagaaccaatgtgttactggtgaaggtactccaaagccacaatctcacaacgacggt
[0027] 181 gacttcgaagaaattccagaagaatacttgcaagcggccgcaggt
[0028] PCR forward primer: 5′-ta g cgg ccc agc cgg cc g ttg ttt aca ct(SfiI)
[0029] PCR reverse primer: 5′-act gcg gcc gc t tgc aag ta(NotI)
[0030] The 5' ends of the PCR forward primer and reverse prim...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
