Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RNA interference method for specificly and high effectively treating CSFV infection and biological formulation

A technology of RNA interference and biological preparations, applied in DNA/RNA fragments, sugar derivatives, gene therapy, etc.

Inactive Publication Date: 2006-12-27
MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report on the application of RNA interference method to produce drugs for the treatment of classical swine fever virus infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RNA interference method for specificly and high effectively treating CSFV infection and biological formulation
  • RNA interference method for specificly and high effectively treating CSFV infection and biological formulation
  • RNA interference method for specificly and high effectively treating CSFV infection and biological formulation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0101] Example 1 siRNA design

[0102] Analyze the genome sequences of classical swine fever virus published in GenBank, select the conserved regions in the genome, and search for AA-N genes according to the requirements of RNAi technology. 19 The characteristic 21nt sequence is analyzed by BlastN and secondary structure. According to the BlastN analysis results, use VNTI3.0 software to analyze their physical and chemical parameters such as (G+C)%, Tm value, internal hairpin loop structure, and select (G+C )% lower sequences, designed 11 siRNA molecular interference sequences against each gene of CSFV.

[0103] The designed sequence and its position in the CSFV genome are shown in Table 10:

[0104] targeting genes

[0105] *: Position relative to reference strain shimen, GenBank accession number: AF092448.

Embodiment 2

[0106] Example 2 Synthesis of siRNA in vitro:

[0107] Press T7 RiboMAX TM Express RNAi System (Promega) instruction manual design and synthesis of the DNA sequence and T7 RNA polymerase binding sequence of the siRNA molecules of 11 fragments selected in Example 1, see appendix figure 1 ; respectively synthesize and transcribe the template DNA of the sense strand and the antisense strand of each siRNA molecule, the sequence is as follows:

[0108] T7 RNA polymerase binding sequence: GGATCCTAATACGACTCACTATA.

[0109] 5B1 sense strand template sequence: AAGACGTCCCCTCTTCTCATTCTATAGTGAGTCGTATTAGGATCC

[0110] Template sequence for the 5B1 antisense strand: AAGAATGAGAAGAGGGACGTCTATAGTGAGTCGTATTAGGATCC

[0111]N1 sense strand template sequence: AACCTGTCACCCTACCTATCCTATAGTGAGTCGTATTAGGATCC

[0112] Template sequence for N1 antisense strand: AAGGATAGGTAGGGTGACAGGTATAGTGAGTCGTATTAGGATCC

[0113] N2 sense strand template sequence: AACTAATCCACTTCAGGGTTCTATAGTGAGTCGTATTAGGATCC

[...

Embodiment 3

[0137] Example 3 The design method of plasmid expression shRNA molecule:

[0138] According to the design requirements of pSilencer3.1H1H1Hygro (Ambion) shRNA vector, design the DNA sequence for expressing shRNA. The design strategy is shown in Table 12. In order to improve the efficiency of correct annealing of sequences into double-stranded DNA molecules, a PCR strategy is designed to use DNA polymerase to synthesize, split the DNA sequence expressing the target shRNA sequence into two partially complementary sequences, and then use VNTI3.0 to assist analysis , so that the complementary paired bases between the two split sequences are 21-23bp, and the paired bases of each split sequence itself are less than 10bp, so as to improve the efficiency of PCR synthesis of double-stranded template DNA.

[0139] The DNA sequences of each shRNA template designed and synthesized are shown in Table 12:

[0140] named

template DNA sequence

N1

GACGGATCCGGATAGGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a specific and high-performance interferometric technique for treating RNA infected by CSFV, which designs specific siRNA sequence for dissimilar genes of hog cholera virus and obtains high-performance and specific interfering RNA molecule for reducing hog cholera virus by T7 RNA polyase external rerecording system and plasmid expression system, so is suitable for commercial manufacture. The biological agent produced by this method has 92.9-99.0% high depression efficiency and can appreciably prevent CSFV affection inside sensitized animals to make the animals relieve from morbidity and death.

Description

technical field [0001] The invention provides a specific and efficient RNA interference method for treating CSFV infection, and simultaneously provides a biological preparation produced by the method, relates to a drug for treating classical swine fever virus infection, and belongs to the technical field of biopharmaceuticals. Background technique [0002] The swine fever virus involved in the present invention is abbreviated CSFV below. [0003] At present, passive immunization (injection of hyperimmune serum) and active immunization methods are generally adopted in order to prevent classical swine fever virus infection, but still can not prevent and treat swine fever epidemic completely. [0004] RNA interference (RNA interference, RNAi) was first reported in 1998. It is a brand-new technology that has been gradually developed in the past two years. one of the most effective methods and is used in the field of virology research. The key to applying RNAi technology to inh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C07H21/02A61K48/00C12N15/113
Inventor 涂长春徐兴然
Owner MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com