Fluorescent quantitative PCR reagent kit for detecting epidermal growth factor receptor gene point mutation

A technology for epidermal growth factor and fluorescence quantification, which is applied in the field of molecular biology, can solve problems such as unsafety, hazards to operators and the environment, and complicated operation process, so as to reduce the probability of result deviation, reduce the possibility of pollution, and operate The effect of simple process

Inactive Publication Date: 2006-12-27
邵建永
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] 1. The detection period is long (the shortest time is about 24 hours from the specimen submission to the result)
[0006] 2. The operation process is complicated and involves the operation after PCR amplification, so it is easy to be contaminated, resulting in unsatisfactory results (see item F for details)
[0007] 3. The interpretation of sequencing results is complex and time-consuming (this is especially prominent when the sample size is large, see item F for details)
[0008] 4. The sensitivity of the detection is not high enough: Katsuhiko et al. found that if the content of the mutated gene accounts for less than 10% of the total genomic DNA, the presence of the mutated sample cannot be detected by direct sequencing (quoted from Endo K, konishi A , Sasaki H et al.Epidermal growth factor receptor gene mutation in non-small cell lungcancer using highly sensitive and fast TaqMan PCR assay.LungCancer.50(3):375-84)
[0009] 5. The sample size of an experimental test is limited, up to 24 cases
[0010] 6. Unsafe: A variety of toxic substances are used in the whole experiment process, such as EB, acrylamide, etc., which are harmful to the operator and the environment
[0011] 7. The cost is relatively high (about 200 yuan for the detection of each site)
[0012] 1. Only point mutations of the EGFR gene can be detected, and the common types of EGFR gene mutations in lung cancer patients include not only point mutations on exon 21 but also deletion mutations on exon 19
[0013] 2. The design of primers is complex and the reaction process is cumbersome, requiring multiple PCR reactions
[0014] 3. Can only be used as a qualitative test

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative PCR reagent kit for detecting epidermal growth factor receptor gene point mutation
  • Fluorescent quantitative PCR reagent kit for detecting epidermal growth factor receptor gene point mutation
  • Fluorescent quantitative PCR reagent kit for detecting epidermal growth factor receptor gene point mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Detection of two deletion mutations on exon 19 of the EGFR gene by fluorescent quantitative PCR (deletion of 15 bases at positions 2235-2249; deletion of 18 bases at positions 2240-2257):

[0039] Design a probe and a pair of common primers that can specifically detect 15 base deletions and 18 base deletions:

[0040] SEQ ID NO: A1 CTGGATCCCAGAAGGTGAGAAA

[0041] SEQ ID NO: A2AGCAGAAACTCACATCGAGGATTT

[0042] SEQ ID NO: A3 FCCGTCGCTATCAAAACATCTCCGAAP (probe for detecting deletion of 15 bases, F represents FAM group, P represents TAMRA group) SEQ ID NO: A46TCGCTATCAAGGAATCGAAAGCCAACP (probe for detecting deletion of 18 bases, 6 represents HEX group , P represents the TAMRA group).

[0043] Then optimize the reaction system for FQ-PCR detection: the reaction system is 15 μl, the forward and reverse primers are 0.15 μl (20 μM), the probe is 0.2 μl (20 μM), the template DNA is 2.5 μl (100-300ng / μl), 2* Taqman universal PCR Master Mix (purchased from Applied Bio...

Embodiment 2

[0045] Example 2 Detection of two point mutations (base substitution mutation at position 2573 and base substitution mutation at position 2582) on exon 21 of the EGFR gene by fluorescent quantitative PCR: firstly, a design capable of specifically detecting the base at position 2573 One probe for base substitution mutation and 2582 base substitution mutation and one pair of common primers:

[0046] SEQ ID NO: B1 AACACCGCAGCATGTCAAGA

[0047] SEQ ID NO: B2 CCTTACTTTGCCTCCTTCTGCAT

[0048] SEQ ID NO: B3 FTTTGGCCCGCCCAAAATCTGTP (probe for detecting mutation at position 2573, (F represents FAM group, P represents TAMRA group). SEQ ID NO: B47CGCACCCAGCTGTTTGGCCP (probe for detecting mutation at position 2582, (7 represents TET group) group, P represents the TAMRA group).

[0049] Then optimize the reaction system for FQ-PCR detection: the reaction system is 15 μl, the forward and reverse primers are 0.15 μl (20 μM), each probe is 0.2 μl (20 μM), template DNA is 0.5 μl (100-300 ng / ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention belongs to the moleculal biology field. It involves a kind of fluorescent quantitive PCR test kit of detection gene mutations. The test kit includes fluorescent quantitive PCR premixed liquid, fluorescent quantitive reaction liquid A, luorescent quantitive reaction liquid B (the feature is that it contains primer and anti-primer and fluorescence probes), positive comparison sample A, positive comparison sample B, positive comparison sample C. This invention features that: short detection time, easy operation, low quality requirement of sample DNA, the result reading is clear, direct with high sensitivity.

Description

[technical field] [0001] The invention belongs to the field of molecular biology, and relates to a fluorescent quantitative PCR kit for detecting gene mutations, which is suitable for detecting the mutations of epidermal growth factor receptor genes in various cancer tissues. [Background technique] [0002] A large number of studies have confirmed that lung cancer patients with epidermal growth factor receptor gene exon 18-21 mutations are very sensitive to gefitinib treatment, so how to quickly detect which patients have this specific change has been An urgent need to become a clinician. In the mutations of these 4 exons, there are mutations in two hotspot exons, that is, the fragment deletion on exon 19 and the base substitution on exon 21 (quoted from 1. Lynch TJ, Bell DW, Sordella R, et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med. 350(21): 2129-39.2. Paez JG, Janne PA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68G01N21/64G01N33/52
Inventor邵建永张海芳
Owner邵建永