Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Important regulation albumen ChK2 of NF-KB signal path

A protein, mutant technology, applied in the field of molecular biology

Inactive Publication Date: 2007-03-07
SHANGHAI GENOMICS
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the NF-κB signal transduction pathway mediated by TNF-α, how TAK1 is activated by TNF-α, and what proteins are involved in this pathway upstream are unknown so far.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Important regulation albumen ChK2 of NF-KB signal path
  • Important regulation albumen ChK2 of NF-KB signal path

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1, the acquisition of Chk2 gene:

[0020] In order to obtain the full length of the Chk2 gene, we designed the following primers, and used the RT product of human tissue mixed RNA as a template to amplify by conventional PCR method.

[0021] Upstream primer: 5'GGCCAATCCGGCCATGCCAAACTCCAGCCAGTCCTCTCAC 3'

[0022] Downstream primer: 5'GGCCTCTAAGGCCTCACAACACAGCAGCACACACAGCC 3'

[0023] The pair of primers contains a SfiI shuttle cloning site, a start codon and a stop codon, and the coding sequence of Chk2 is between the restriction sites. A band with a size of about 1.6 kb was obtained by PCR amplification with the pair of primers. The fragment was recovered, cloned into a vector and then sequenced to obtain the full-length sequence of Chk2, a total of 1632 bp (SEQ ID NO: 1).

Embodiment 2

[0024] Embodiment 2, Chk2 sequence analysis

[0025] The 1632bp sequence we cloned contains the complete coding region of the Chek2 gene, which encodes a protein (SEQ ID NO: 2) consisting of 543 amino acids. Among them, amino acids 93-201 constitute the FHA fork-head-associated domain, and amino acids 220-486 constitute the kinase domain. The coding region of human Chk2 was homologously compared with the mouse gene sequence, and there was a certain degree of homology.

Embodiment 3

[0026] Embodiment 3, construct the mammalian expression type of Chk2 and its ATP binding site mutant (K249A)

[0027]In order to further study the function of Chk2, a SfiI site was added to the multiple cloning site of pcDNA3. 1 carrier. The Chk2 amplified by PCR was cloned into the constructed pcDNA3.1 eukaryotic expression vector with a flag-tail through the SfiI restriction site. At the same time, the 249th lysine (lys) of Chk2 was changed to alanine (Ala) by point mutation technology. The two plasmids were transfected into 293T cells respectively, and the cells were collected after 24 hours of culture. After being lysed with cell lysate, the supernatant was collected by centrifugation and subjected to SDS electrophoresis. Using an anti-flag monoclonal antibody (purchased from Sigma), the protein expression of Chk2 wild type and its ATP binding site mutant was detected by Western blot analysis ( FIG. 1 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mutation typed ChK2 protein with amino sequence as SEQ ID NO:2, wherein the 249th lysine is mutated into alanine; the mutation ChK2 protein can be NF-kB channel inhibitor.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a mutant ChK2 protein and its use as an inhibitor of NF-KB signaling pathway. Background technique [0002] "High-quality" drug target genes (referred to as drug targets) are the source of new drug development. Although the completion of the Human Genome Project has brought exciting prospects for treating diseases for humans, except for macromolecular protein drugs, genes themselves are not necessarily drug targets. From genes to new drugs, many essential links are still missing in this chain. Among them, gene function research, because it can reveal the mysteries of human health and diseases at the molecular level, and find out the most important disease-causing genes, has become a key step in determining whether genes can become drug targets. Large foreign pharmaceutical companies have found that although gene sequence data and bioinformatics analysis alone can find a large n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/52A61K38/48A61P29/00A61P35/00
Inventor 束放孙筱清吴骏罗楹
Owner SHANGHAI GENOMICS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com