Important regulation albumen ChK2 of NF-KB signal path
A protein, mutant technology, applied in the field of molecular biology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Embodiment 1, the acquisition of Chk2 gene:
[0020] In order to obtain the full length of the Chk2 gene, we designed the following primers, and used the RT product of human tissue mixed RNA as a template to amplify by conventional PCR method.
[0021] Upstream primer: 5'GGCCAATCCGGCCATGCCAAACTCCAGCCAGTCCTCTCAC 3'
[0022] Downstream primer: 5'GGCCTCTAAGGCCTCACAACACAGCAGCACACACAGCC 3'
[0023] The pair of primers contains a SfiI shuttle cloning site, a start codon and a stop codon, and the coding sequence of Chk2 is between the restriction sites. A band with a size of about 1.6 kb was obtained by PCR amplification with the pair of primers. The fragment was recovered, cloned into a vector and then sequenced to obtain the full-length sequence of Chk2, a total of 1632 bp (SEQ ID NO: 1).
Embodiment 2
[0024] Embodiment 2, Chk2 sequence analysis
[0025] The 1632bp sequence we cloned contains the complete coding region of the Chek2 gene, which encodes a protein (SEQ ID NO: 2) consisting of 543 amino acids. Among them, amino acids 93-201 constitute the FHA fork-head-associated domain, and amino acids 220-486 constitute the kinase domain. The coding region of human Chk2 was homologously compared with the mouse gene sequence, and there was a certain degree of homology.
Embodiment 3
[0026] Embodiment 3, construct the mammalian expression type of Chk2 and its ATP binding site mutant (K249A)
[0027]In order to further study the function of Chk2, a SfiI site was added to the multiple cloning site of pcDNA3. 1 carrier. The Chk2 amplified by PCR was cloned into the constructed pcDNA3.1 eukaryotic expression vector with a flag-tail through the SfiI restriction site. At the same time, the 249th lysine (lys) of Chk2 was changed to alanine (Ala) by point mutation technology. The two plasmids were transfected into 293T cells respectively, and the cells were collected after 24 hours of culture. After being lysed with cell lysate, the supernatant was collected by centrifugation and subjected to SDS electrophoresis. Using an anti-flag monoclonal antibody (purchased from Sigma), the protein expression of Chk2 wild type and its ATP binding site mutant was detected by Western blot analysis ( FIG. 1 ).
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
