Candida albicans cell wall adhesion factor gene and its use

A technology of Candida albicans and host cells, applied in genetic engineering, plant gene improvement, application, etc., can solve the problems such as cell wall adhesion factors of Candida albicans that have not been reported

Inactive Publication Date: 2007-04-18
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the presence of cell wall adhesion factors in C. albicans has not been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Candida albicans cell wall adhesion factor gene and its use
  • Candida albicans cell wall adhesion factor gene and its use
  • Candida albicans cell wall adhesion factor gene and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0120] Acquisition and sequence analysis of CaFLO11 gene from Candida albicans

[0121] Using the principle of functional complementarity, the Candida albicans genomic DNA library constructed by conventional methods was transferred into a conventional haploid Saccharomyces cerevisiae flo8 deletion strain, and those genes that could correct the growth defects of the deletion strain on agar invasion were screened. In this screen, a clone was obtained that strongly corrected the invasive growth defect of the flo8-deficient strain. The clone was subjected to restriction analysis and sequence determination analysis and comparison, and it was known from online BLASTn and Candida albicans genome database that the clone contained a reading frame of 3363bp (Fig. 1).

[0122] Based on the comparison results, the following primers were synthesized:

[0123] Upstream primers:

[0124] CGCATCGATATGAAAGTTTCTCAAAATTTTACCATTAGCTGG (SEQ ID NO: 3)

[0125] Downstream primers:

[0126] GTCAT...

Embodiment 2

[0132] Candida albicans CaFLO11 gene can complement the function of Saccharomyces cerevisiae flo11 deletion strain

[0133] In Saccharomyces cerevisiae, the deletion of the Scflo11 gene resulted in the failure of diploid cells to form hyphae, haploid cells could not perform invasive growth, and could not form flocculated sediments. In order to verify the relationship between CaFLO11 and ScFLO11, in this example, using the PCR method, the upstream primer 5'TTGAGGTACCCTGCGCTGACTAAGATCGTCAA 3' (SEQ ID NO: 5) and the downstream primer 5'CGCAGAGCTCGCTGTCCATGCTATTTATATTGGG 3' (SEQ ID NO: 6) were used to amplify Then insert the amplified product into the expression vector Yeplac181 (US patent 5,674,721 or 5,759,833; or US patent application 20020081684 or 20030064436) to obtain the expression plasmid Yeplac181-CaFLO11.

[0134] The plasmid Yeplac181-CaFLO11 was transformed into conventional Saccharomyces cerevisiae flo11 diploid deletion strain and haploid deletion strain. The resul...

Embodiment 3

[0138] Knockout of the gene CaFLO11 in Candida albicans

[0139] In order to study the function and role of the CaFLO11 gene in the morphogenesis of Candida albicans, in this example, the PCR method was used to knock out the CaFLO11 gene. The knockout strategy is shown in Figure 4A. The specific method is as follows:

[0140] Using 5' primer: TGTGATGGCGGTTCTTGTTCTCATACAGCAGTAACTACGGGTGTCACTATCACCGTCGTTTTCCCAGTCACGACGTT (SEQ ID NO: 7)

[0141] and 3' primer: TTGAAAGAACACTGGAAGAAGCTTCAACTTCAGGACCATTGGTAGGAACTGATGGGCTGGTGTGGAATTGTGAGCGGATA (SEQ ID NO: 8)

[0142] (The 60 bases at the 5' end of each primer are homologous to the CaFLO11 gene, and the 20 bases at the 3' end are paired with the DNA in the template plasmid for PCR amplification)

[0143] With conventional vectors pGEM-HIS1, pGEM-URA3 and pGEM-ARG4 (R.Bryce Wilson, DanaDavis, and Aaron P.Mitchell, Journal of Bacteriology, March 1999, p.1868-1874, Vol.181, No.6; Marcus E.Marvin, Robert P.Mason and Annette M.Cashmore...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a new cell wall adhesion factor CaFlo11 protein of candida albicans, polynucleotide for coding CaFlo11 protein and method for producing this CaFlo11 protein by utilizing recombination technique. Besides, said invention also provides application of polynucleotide for coding said CaFlo11 protein. In the saccharomyces cerevisiae the high-expression CaFlo11 gene can raise adhesion between yeast cells, and can promote formation of flocculent precipitate, at the same time can give the capability to saccharomyces cerevisiae cells and make them be adhered on the gelatin, so that said CaFlo11 is a good cell wall adhesion factor.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular, the invention relates to a new polynucleotide encoding Candida albicans cell wall adhesion factor CaFLO11 and a polypeptide encoded by the polynucleotide. The present invention also relates to the use and preparation of such polynucleotides and polypeptides. Background technique [0002] Candida albicans, also known as Candida albicans (Candida albicans), is an opportunistic human pathogenic fungus isolated clinically. It can cause a wide range of superficial and deep system infections. The infection sites include the oral cavity, female vagina, etc., causing diseases such as thrush and vaginitis. Sepsis, severe can lead to death (Odds, F.C. 1994. J Am Acad Dermatol. 31:S2-S5.). [0003] Candida albicans has different growth forms under different growth conditions, including yeast form, pseudohyphae and hyphae. This morphological conversion ability directly affects the pathogenicity...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/37C12N15/31C12N15/63C12P21/02C07K16/00G01N33/53
Inventor陈江野李砚东
OwnerSHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI