Candida albicans cell wall adhesion factor gene and its use
A technology of Candida albicans and host cells, applied in genetic engineering, plant gene improvement, application, etc., can solve the problems such as cell wall adhesion factors of Candida albicans that have not been reported
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0120] Acquisition and sequence analysis of CaFLO11 gene from Candida albicans
[0121] Using the principle of functional complementarity, the Candida albicans genomic DNA library constructed by conventional methods was transferred into a conventional haploid Saccharomyces cerevisiae flo8 deletion strain, and those genes that could correct the growth defects of the deletion strain on agar invasion were screened. In this screen, a clone was obtained that strongly corrected the invasive growth defect of the flo8-deficient strain. The clone was subjected to restriction analysis and sequence determination analysis and comparison, and it was known from online BLASTn and Candida albicans genome database that the clone contained a reading frame of 3363bp (Fig. 1).
[0122] Based on the comparison results, the following primers were synthesized:
[0123] Upstream primers:
[0124] CGCATCGATATGAAAGTTTCTCAAAATTTTACCATTAGCTGG (SEQ ID NO: 3)
[0125] Downstream primers:
[0126] GTCAT...
Embodiment 2
[0132] Candida albicans CaFLO11 gene can complement the function of Saccharomyces cerevisiae flo11 deletion strain
[0133] In Saccharomyces cerevisiae, the deletion of the Scflo11 gene resulted in the failure of diploid cells to form hyphae, haploid cells could not perform invasive growth, and could not form flocculated sediments. In order to verify the relationship between CaFLO11 and ScFLO11, in this example, using the PCR method, the upstream primer 5'TTGAGGTACCCTGCGCTGACTAAGATCGTCAA 3' (SEQ ID NO: 5) and the downstream primer 5'CGCAGAGCTCGCTGTCCATGCTATTTATATTGGG 3' (SEQ ID NO: 6) were used to amplify Then insert the amplified product into the expression vector Yeplac181 (US patent 5,674,721 or 5,759,833; or US patent application 20020081684 or 20030064436) to obtain the expression plasmid Yeplac181-CaFLO11.
[0134] The plasmid Yeplac181-CaFLO11 was transformed into conventional Saccharomyces cerevisiae flo11 diploid deletion strain and haploid deletion strain. The resul...
Embodiment 3
[0138] Knockout of the gene CaFLO11 in Candida albicans
[0139] In order to study the function and role of the CaFLO11 gene in the morphogenesis of Candida albicans, in this example, the PCR method was used to knock out the CaFLO11 gene. The knockout strategy is shown in Figure 4A. The specific method is as follows:
[0140] Using 5' primer: TGTGATGGCGGTTCTTGTTCTCATACAGCAGTAACTACGGGTGTCACTATCACCGTCGTTTTCCCAGTCACGACGTT (SEQ ID NO: 7)
[0141] and 3' primer: TTGAAAGAACACTGGAAGAAGCTTCAACTTCAGGACCATTGGTAGGAACTGATGGGCTGGTGTGGAATTGTGAGCGGATA (SEQ ID NO: 8)
[0142] (The 60 bases at the 5' end of each primer are homologous to the CaFLO11 gene, and the 20 bases at the 3' end are paired with the DNA in the template plasmid for PCR amplification)
[0143] With conventional vectors pGEM-HIS1, pGEM-URA3 and pGEM-ARG4 (R.Bryce Wilson, DanaDavis, and Aaron P.Mitchell, Journal of Bacteriology, March 1999, p.1868-1874, Vol.181, No.6; Marcus E.Marvin, Robert P.Mason and Annette M.Cashmore...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com