Unlock instant, AI-driven research and patent intelligence for your innovation.

Compound allyl isothiazole induced W-box element and its application

A kind of technology of allyl isothiazole and chemical substance, applied in the field of genetic engineering

Inactive Publication Date: 2010-05-19
FUDAN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report on the application of PBZ-induced promoters to transgenic plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Obtaining W-box cis-element fragments

[0029] According to the search, summary and bioinformatics analysis of PBZ-induced genes in existing studies, PBZ-induced SAR in plants may involve various signal transduction pathways in plants, among which WRKY, which plays an important role in plant stress and disease resistance The gene may play an important role in the PBZ-induced signaling pathway; in addition, nucleotide sequence analysis also shows that multiple W-boxes (28bp, SEQ ID No.1) exist in the upstream activation of rice disease resistance-related genes that can be induced by PBZ child. Therefore, an artificially synthesized nucleotide fragment was designed according to the sequence (SEQ ID No.6) of the 5' upstream promoter of the more studied barley disease resistance-related gene:

[0030] 5' CTAGACACACTTAATTTGACCGAGTAACATTCGCCACTAGTAAGCTTCTGCA3' (SEQ ID No. 2)

[0031] 5'GAAGCTTACTAGTGGCGAATGTTACTCGGTCAAATTAAGTGTGT 3' (SEQ ID No.3)

[0032] Dissol...

Embodiment 2

[0034] Embodiment 2: the construction of the plant transgenic vector with promoter fragment

[0035] The sequence-verified plasmid was digested with XbaI and SpeI, electrophoresed, and recovered to obtain the W-box cis-element sequence. The sequence was cloned into the upstream of the basic promoter (mini promoter) on the pCAMBIA 1301 binary transformation vector in three combinations of 1X, 2X and 4X to drive the expression of the GUS gene, and correspondingly obtained three vectors: pCW-box1 , pCW-box2 (SEQ ID No. 4), pCW-box3 (SEQ ID No. 5). After PCR verification, the Agrobacterium strain LBA4404 was transformed by electric shock method. Screen on LB solid medium containing three antibiotics, rifampicin, streptomycin and kana, pick a single colony, and shake the bacteria in a small tube. Colony PCR was performed using the bacterial liquid as a template and the corresponding primer pairs of each fragment as primers to verify whether each plasmid had been transformed into ...

Embodiment 3

[0036] Example 3: Research on reporter gene expression driven by PBZ induction in transgenic plants

[0037] Agrobacterium carrying pCW-box1, pCW-box2, pCW-box3 was transformed into Arabidopsis. Cultivate Agrobacterium strains at 28°C, 120rpm to OD600=1.2; 5000rpm (the centrifuge used is Hitachi CR22E, the rotor is R22A2, No. 24), 4°C, centrifuge for 10min, collect the bacteria by multiple centrifugation; 5% sucrose solution to suspend bacteria When the cells reached OD600=0.8, the cells were evenly suspended into a turbid solution, and then Silwet L-77 (0.03%) was added; the plants were submerged in the bacterial solution for 3 seconds; covered and kept moist for 24 hours, and cultured under normal conditions.

[0038] transformed T 0 Seeds produced by Arabidopsis thaliana (T 1 Generation) After one week of vernalization in the dark at 4°C, the screening began. The seeds are divided into 1.5ml Ep tubes, each tube has a volume of about 100ul, and liters of mercury (0.1% HgC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of gene engineering technology, and is especially one kind of cis-form element for separating and utilizing nucleic acid. The element is originated from thepromoter sequence in the upstream of wheat disease resistance related gene. Recombinant DNA is obtained through repeating the nucleotide sequence and single element or its cis-form series of the target product gene and fusing the obtained promoter, and used in transforming plant to obtain new transgenic plant. In the new plant, the expression of the target gene with the recombinant DNA is regulated and controlled by the chemical inducer of probenazole (PBZ) and its active metabolite 1, 2-benzisothiazole-1, 1-dioxide (BIT).

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to a cis-element induced by a chemical substance allylisothiazole or its active metabolite and its application. The cis element is derived from the promoter sequence upstream of the disease resistance related gene in barley. The nucleotide sequence of the gene encoding the desired target product is fused with the promoter obtained after the single element or its cis-tandem repetition to obtain a recombinant DNA, and the plant is transformed with the recombinant DNA to obtain a new transgenic plant. In the new plant, the expression of the target gene in the recombinant DNA is controlled by allylisothiazole probenazole (3-allyloxy-1,2-benzisothiazole-1,1-dioxide, PBZ) or its active metabolite 1,2-benzisothiazole- Regulation of chemical inducers of 1,1-dioxide (BIT). Background technique [0002] In the past ten years, people have obtained hundreds of functional genes wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/10C12N15/63
Inventor 蒯本科杨进孝高炯周茜余进
Owner FUDAN UNIV