Compound allyl isothiazole induced W-box element and its application
A kind of technology of allyl isothiazole and chemical substance, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0028] Example 1: Obtaining W-box cis-element fragments
[0029] According to the search, summary and bioinformatics analysis of PBZ-induced genes in existing studies, PBZ-induced SAR in plants may involve various signal transduction pathways in plants, among which WRKY, which plays an important role in plant stress and disease resistance The gene may play an important role in the PBZ-induced signaling pathway; in addition, nucleotide sequence analysis also shows that multiple W-boxes (28bp, SEQ ID No.1) exist in the upstream activation of rice disease resistance-related genes that can be induced by PBZ child. Therefore, an artificially synthesized nucleotide fragment was designed according to the sequence (SEQ ID No.6) of the 5' upstream promoter of the more studied barley disease resistance-related gene:
[0030] 5' CTAGACACACTTAATTTGACCGAGTAACATTCGCCACTAGTAAGCTTCTGCA3' (SEQ ID No. 2)
[0031] 5'GAAGCTTACTAGTGGCGAATGTTACTCGGTCAAATTAAGTGTGT 3' (SEQ ID No.3)
[0032] Dissol...
Embodiment 2
[0034] Embodiment 2: the construction of the plant transgenic vector with promoter fragment
[0035] The sequence-verified plasmid was digested with XbaI and SpeI, electrophoresed, and recovered to obtain the W-box cis-element sequence. The sequence was cloned into the upstream of the basic promoter (mini promoter) on the pCAMBIA 1301 binary transformation vector in three combinations of 1X, 2X and 4X to drive the expression of the GUS gene, and correspondingly obtained three vectors: pCW-box1 , pCW-box2 (SEQ ID No. 4), pCW-box3 (SEQ ID No. 5). After PCR verification, the Agrobacterium strain LBA4404 was transformed by electric shock method. Screen on LB solid medium containing three antibiotics, rifampicin, streptomycin and kana, pick a single colony, and shake the bacteria in a small tube. Colony PCR was performed using the bacterial liquid as a template and the corresponding primer pairs of each fragment as primers to verify whether each plasmid had been transformed into ...
Embodiment 3
[0036] Example 3: Research on reporter gene expression driven by PBZ induction in transgenic plants
[0037] Agrobacterium carrying pCW-box1, pCW-box2, pCW-box3 was transformed into Arabidopsis. Cultivate Agrobacterium strains at 28°C, 120rpm to OD600=1.2; 5000rpm (the centrifuge used is Hitachi CR22E, the rotor is R22A2, No. 24), 4°C, centrifuge for 10min, collect the bacteria by multiple centrifugation; 5% sucrose solution to suspend bacteria When the cells reached OD600=0.8, the cells were evenly suspended into a turbid solution, and then Silwet L-77 (0.03%) was added; the plants were submerged in the bacterial solution for 3 seconds; covered and kept moist for 24 hours, and cultured under normal conditions.
[0038] transformed T 0 Seeds produced by Arabidopsis thaliana (T 1 Generation) After one week of vernalization in the dark at 4°C, the screening began. The seeds are divided into 1.5ml Ep tubes, each tube has a volume of about 100ul, and liters of mercury (0.1% HgC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More