Diagnostic tests for a new spirochete, Borrelia lonestari sp. nov.

a technology of borrelia lonestari and diagnostic tests, applied in the field of infection and disease, can solve the problems of no means of identification of the new spirochete, no means of diagnosis of infection, no compositions for clinical tests, laboratory assays, etc., and achieve the effect of preventing protease digestion

Inactive Publication Date: 2005-08-11
BARBOUR ALAN +1
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

"The present invention provides compositions, methods, and kits for detecting a new spirochete that is associated with a Lyme disease-like illness. The new spirochete is a new species of Borrelia that has been identified based on its unique flagellin protein and nucleic acid sequences. The invention provides specific allotypes, alleles, and nucleotides that are unique to this new species and can be used to detect it in a sample. The invention helps to improve the diagnosis and treatment of Lyme disease by providing a more accurate and reliable method for detecting the presence of the new spirochete."

Problems solved by technology

Although there is much known about Lyme disease, there are currently no means of identification of the new spirochete associated with the aforedescribed Lyme disease-like pathology and further, no means of diagnosis of infection, compositions for clinical tests, or laboratory assays for diagnosing a patient exhibiting Lyme disease-like symptoms but testing negative for Lyme disease.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Diagnostic tests for a new spirochete, Borrelia lonestari sp. nov.

Examples

Experimental program
Comparison scheme
Effect test

example 1

Evidence for a Spirochete in A. americanum that Cross-Reacts with Anti-B. burgdorfei Antiserum

[0118] The present example provides evidence for a spirochete in A. americanum that cross-reacts with anti-B. Burgdorfei antiserum at high concentrations of the antiserum.

[0119] For the present study, A. americanum ticks were collected from field locations in Missouri, New Jersey, New York, North Carolina, and Texas and examined with anti-B. burgdorferi polyclonal antisera in concentrations giving cross-reactions with other Borrelia spp. (Maupin et al., 1991). Fluorescent photomicrographs were taken of B. turicatae, a relapsing fever agent, and spirochetes in the crushed midgut of an A. americanum tick stained with a 1:10 dilution of fluorescein isothiocyanate-conjugated rabbit antibodies to B. burgdorferi (Maupin et al., 1991). Approximately 2% of the ticks, both nymphs and adults, in Missouri, New Jersey, New York, and North Carolina contained immunoreactive spirochetes of between 10 an...

example 2

The A. americanum Spirochete is a New Borrelia Species, B. lonestari sp. Nov.

[0121] The present example describes the inventors' analysis of the A. americanum spirochete that led to their determination that the spirochete is a new Borrelia species.

[0122] The present inventors used the polymerase chain reaction (PCR™) and amplification of conserved genes using primers designed on the basis of sequences of possibly-related organisms (Relman, 1993). The genes for 16S rRNA and flagellin, the major structural protein of flagella, of several Borrelia spp. were available, and alignment revealed regions of genus-specific sequences.

[0123]A. americanum ticks were collected in New Jersey and New York from the field by flagging. Flagging is a technique described in Maupin et al., (1991) which reference is specifically incorporated herein by reference. A. americanum ticks from Texas had been removed from human hosts and submitted to the Department of Health. Ticks were dissected with sterile ...

example 3

Regions of B. lonestari sp. Nov. Flagellin Gene and rRNA Gene Sequences Differ from Those of Other Borrelia sp.

[0129] The present example describes those regions of the B. lonestari sp. nov. flagellin amino acid and rRNA sequences that differ from those of other Borrelia sp.

[0130] With the inventors' collection of evidence that the Amblyomma spirochete was a new Borrelia sp., sets of primers were used to amplify a larger region of the flagellin gene and most of the 16S rRNA gene. The primers were based on identical sequences in flagellin and 16S rRNA genes of Borrelia spp. The primers differed in sequence at two or more positions from homologous sequences of other spirochetes and bacteria. In the following primer sequences, the positions listed in parentheses refer to B. burgdorferi flagellin (Fla) and 16S rRNA (16Rna) genes:

FlaLL,SEQ ID NO:115′ACATATTCAGATGCAGACAGAGGT3′ (301-324);FlaRL,SEQ ID NO:123′TGTTAGACGTTACCGTTACTAACG5′ (942-965);16RnaL,SEQ ID NO:135′CTGGCAGTGCGTCTTAAGCA3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
temperaturesaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

Bites from Amblyomma americanum, a hard tick, have been associated with a Lyme disease-like illness in the southeastern and south-central United States. Present in 2% of ticks collected in four states were uncultivable spirochetes. Through use of the polymerase chain reaction, partial sequences of the flagellin and 16s rRNA genes of microorganisms from Texas and New Jersey were obtained. The sequences showed that the spirochete was a Borrelia sp. but distinct from other known members of this genus, including B. burgdorferi, the agent of Lyme disease. Species-specific differences in the sequences of the flagellin protein, the flagellin gene and the 16s rRNA gene between the new Borrelia species and previously known species provide compositions and methods for assay for determining the presence of this new spirochete, or for providing evidence of past or present infection by this spirochete in animal reservoirs and humans.

Description

[0001] The government owns rights in the present invention pursuant to grant number AI24424 from the National Institutes of Health.FIELD OF THE INVENTION [0002] The present invention relates generally to the fields of infection and disease. More particularly, it concerns the identification of a new spirochete carried by the hard tick, Amblyomma americanum, found by the present inventor to be associated with a Lyme disease-like illness in the southeastern and south-central United States. Most particularly, the invention provides compositions, methods, and kits for the identification of the new spirochete for diagnostic purposes. DESCRIPTION OF THE RELATED ART [0003] A paradox about Lyme disease is the report of this tick-borne infection from areas in which transmission of the etiologic agent, B. burgdorferi, has not been documented (Sigal et al., 1991; Barbour et al., 1993). This phenomenon has been reported from Georgia and Missouri, but may be common in other parts of the southeast...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A61K39/00A61P33/02C07K14/20
CPCA61K39/00C07K14/20Y10S436/811Y10S530/825C07K2319/00A61P33/02Y02A50/30
InventorBARBOUR, ALANCARTER, CAROL
OwnerBARBOUR ALAN