28 results about "Spirochaete" patented technology

The invention relates to a kit for detecting lyme disease spirochetes and a detection method of the lyme disease spirochetes. The kit comprises the following primers and probes: 5 to 23S-1F, GGTCAAATAATAAGAGTCTA5-23S-1R, another purpose of the invention is to provide application of the primer probe combination in preparation of a kit for detecting lyme disease spirochetes and / or genotypes. Another purpose of the invention is to provide a kit for lyme disease spirochete detection. The kit comprises the primer and probe combination.

The invention discloses a spirochete-like multiplex nucleic acid detection kit and a matched artificial chromosome engineering bacterium quality control product, and belongs to the field of molecular biology. The kit comprises a leptospira specific primer probe group, a hot-regressive spirospira specific primer probe group, a borrelia burgdorferi specific primer probe group and other PCR reaction system components, and can realize high-specificity, high-sensitivity and high-accuracy quantitative detection of target genes of the leptospira, the hot-regressive spirospira and the borrelia burgdorferi. The standard requirements of fluorescent PCR and digital PCR multi-gradient standard curve establishment, nucleic acid extraction kit performance verification and clinical diagnosis are met. According to the quality control product, target gene consistency sequences of leptospira, retro-hot spirospira and borrelia burgdorferi are integrated into an escherichia coli artificial chromosome through a homologous recombination technology, the extraction characteristic of a cell structure simulation sample is reserved, the copy number is calibrated through digital PCR, and the quality control product has nuclease degradation resistance.

A chewable tablet a first probiotic strain of bacteria that inhibits Streptococcus mutans; a second probiotic strain of bacteria that inhibits one or more of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia (i.e., the red complex); a remineralizing agent such as hydroxyapatite with a micron-level particle size; and a sugar alcohol such as xylitol.

Provided in the present invention are a detection reagent for detecting coccoid forms and spiral forms of Helicobacter pylori under a gastroscope and the use thereof, which belong to the technical field of biomedicine. A detection reagent for detecting coccoid forms of Helicobacter pylori, which takes anthocyanin as a pH value indicator, and further comprises hydrogen peroxide. Given that the coccoid forms of Helicobacter pylori have catalase activity, the pH value is increased by means of acting on the substrate hydrogen peroxide, and then the distribution of the coccoid forms of Helicobacter pylori on gastric mucosa is displayed on the basis of a change in color of the anthocyanin.

The invention relates to the technical field of syphilis detection, in particular to a method and a system for rapidly detecting negative endpoint titer. The method comprises the following steps: (1) obtaining a reaction result image of a non-treponema pallidum antigen serum test result; (2) inputting the reaction result image into a reaction intensity classification model, and outputting reaction intensity classification; determining dilution multiples for next detection according to the reaction intensity classification, and skipping unnecessary dilution multiples; and (3) preparing a new to-be-detected sample according to the dilution ratio determined in the step (2), and repeating the steps (1) and (2) until the output result of the reaction intensity classification model is negative, so as to obtain a negative endpoint titer. The novel method for detecting the negative endpoint titer and the corresponding system are obtained by combining deep learning technology research, the syphilis negative endpoint titer detection efficiency and accuracy are remarkably improved, test reagents are saved, and the method and the system have important application value.

The invention relates to a reagent card box for detecting spirochetes of severe fever with thrombocytopenia syndrome virus, Erhi and Lyme disease, relates to the technical field of molecular biology detection, and comprises a primer probe composition for detecting spirochetes of severe fever with thrombocytopenia syndrome virus, Erhi and Lyme disease, and a kit for detecting spirochetes of severe fever with thrombocytopenia syndrome virus, Erhi and Lyme disease. The primer and the probe for detecting the severe fever with thrombocytopenia syndrome virus comprise a forward primer as shown in SEQ ID NO: 1, a reverse primer as shown in SEQ ID NO: 2 and a probe as shown in SEQ ID NO: 9, the primer and the probe used for Escherichia coli detection comprise a forward primer shown in SEQ ID NO: 3, a reverse primer shown in SEQ ID NO: 4 and a probe shown in SEQ ID NO: 10. The primer and the probe for lyme disease spirochete detection comprise a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6 and a probe of SEQ ID NO: 11. The reagent card box disclosed by the invention adopts a POCT (Point-of-Care Testing) technology to carry out multiple real-time fluorescent PCR amplification detection on nucleic acids of the severe fever with thrombocytopenia syndrome virus, the Escherichia body and the Lyme disease spirochetes, and has timeliness, closeness, accuracy and convenience.

The invention relates to the technical field of animal husbandry, and discloses application of hemicellulose and mannan in regulation of growth performance of sheep. The content of hemicellulose is 10.3% DM or 17% DM, and the addition amount of mannan is 80-160 mg / kg DM. According to the application of the hemicellulose and the mannan in regulating the growth performance of the sheep, the mannan is added into daily ration, so that the digestibility of animals to dry matters, crude proteins, neutral detergent fibers and acid detergent fibers can be increased, and the content of total acid, acetic acid, propionic acid, butyric acid and other volatile fatty acids in rumen can be increased; according to the present invention, with the feed, the richness and the diversity of the flora are increased, the richness of the firmicophyta, the spirochete and the like is improved, the intestinal flora of the sheep is adjusted, the blood sugar is reduced, and the daily ration with different hemicellulose levels has different influences on the growth performance, the rumen microorganisms, the metabolite and the lipid metabolism of the sheep; and a theoretical basis is provided for research and development of the yeast-source functional feed additive.

A method for identifying affiliation of Leptospira isolates to a specific serogroup and serovar using analysis of the percentage composition of monosaccharides in LPS of Leptospira was disclosed, it allows the identification of the affiliation of the tested strains without the use of antibody techniques, which reduces the costs of diagnosis and allows it to be carried out in less specialized research units. The method can find a particular use in veterinary diagnostics and diagnostics of zoonoses.

The invention relates to an aptamer which binds to the CspZ protein present on the surface of bacteria of the genus Borrelia, and to the use thereof in an in vitro method for diagnosing an infection with a bacterium of the genus Borrelia in a subject.

The present invention discloses a variant D-allulose 3-epimerase (DAEase) that is distinguished from a wild-type DAEase derived from Spirochaetales bacterium (spDAEase) by at least one amino acid sequence variation comprising substitution of an 5 amino acid residue corresponding to position 69, 119, 138, 175, 203, 208, 229, 240, or 265 of SEQ ID NO. 1; or a variant DAEase that is distinguished from a wild-type DAEase derived from Clostridium cellulolyticum (ccDAEase) by an amino acid sequence variation comprising substitution of an amino acid at position 46 and / or a truncation of C-terminal end of in SEQ ID NO. 2.

The present invention discloses a kind of endophytic fungus spiral Chaetomium of Dendrobium and its application in the growth of Dendrobium. It is classified and named as spiral Chaetomium Chaetomium spirochaete, and its classification status is Ascomycetes, Ascomycetes, Chaetomaceae, Chaetomium, and the strain number is JSNLSHQH-5. It has been deposited in the General Microbiological Center of China Microbiological Culture Collection Committee, and the deposit number is CGMCC NO.18542. The deposit date is September 2, 2019. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101. The spiral Chaetomium spirochaete strain JSNLSHQH-5 of the present invention has obvious growth-promoting effect on Dendrobium officinale seedlings, promotes its growth, and enhances its stress resistance. At the same time, it can be artificially cultured, the culture conditions are simple, and it is easy to mass produce, and it has good development and application prospects.

The invention belongs to the technical field of slow-release fertilizer preparation, in particular to a bio-energy-accumulating and synergistic slow-release fertilizer and a preparation process thereof. Aiming at the problem that it is difficult for the existing slow-release fertilizer to completely match the fertilizer absorption law of crops in different growth and development periods in nutrient release, resulting in insufficient nutrient supply of crops in certain periods and inability to effectively improve soil structure and environment, the following scheme is proposed, which includes raw materials, and the raw materials include the following components in parts by weight: 20-80 parts of polyvinyl alcohol. The invention can effectively improve soil structure and environment and significantly improve fertilizer utilization rate by using polyvinyl alcohol, polyethylene, polyamide, polyurea, paraffin, polyglutamic acid, zinc polyaspartate, nitrification inhibitor, urease, fulvic acid, humus, amino acid, actinomycetes, spirochetes, ammonium magnesium phosphate, polypropylene, polyvinyl chloride, urea phosphate, talcum powder, sulfur, biochar, zeolite and diatomaceous earth.

The utility model discloses a bearing device for a special card for a non-treponema pallidum antigen serum test, which belongs to the technical field of serum tests.The bearing device for the special card for the non-treponema pallidum antigen serum test comprises a supporting and placing mechanism, and the supporting and placing mechanism comprises a supporting seat; the protection mechanism comprises a limiting anti-overflow assembly, the limiting anti-overflow assembly comprises a fixed anti-overflow plate and a fixed supporting frame, the fixed anti-overflow plate and the fixed supporting frame are connected to the two ends of the top of the supporting base in a limiting mode, and movable anti-overflow plates are slidably connected to the two sides of the fixed anti-overflow plate and the two sides of the fixed supporting frame in a limiting mode; an experiment card is placed in a frame defined by the fixed spill-proof plate, the fixed supporting frame and the movable spill-proof plate, auxiliary grooves are symmetrically formed in the two sides of the supporting base, fingers, wearing gloves, of medical workers can be conveniently placed in the auxiliary grooves, meanwhile, the bearing device can be easily pinched up, direct contact with the card is avoided, reactant contamination is prevented, and operation safety is improved.

The present inventors have discovered a substance in Salvia pisidica (Boiss. & Heldr.), a type of sage, that can kill Borrelia and Yersinia bacteria in vitro and in vivo. Until now, it has been thought that the ethanol extract or oil of Salvia pisidica has antibacterial effects against gram-positive bacteria. Previous experiments support this scientific view.

Compositions and methods are provided for the detection, diagnosis and prognosis of Lyme disease (LD), including methods for confirming Borrelia spp. infection by contacting a whole blood sample from a subject suspected of having LD with a plurality of synthetic peptides comprising T cell epitope-containing regions derived from Borrelia proteins expressed at different stages of Lyme disease in vitro, and indirectly detecting LD-specific activated T cells by assaying for the production of indicators of T cell immune response (e.g., interferon-gamma) produced in response to stimulation by the peptides. Also disclosed are methods for predicting the elimination of LD spirochetes in a LD patient who has undergone treatment for LD by contacting a whole blood sample from the subject with peptides comprising specific T cell epitope regions of Borrelia proteins expressed at different stages of Lyme disease, and confirming the absence of Borrelia-specific activated T cells in the sample by the absence of detectable indicators of T cell immune response (e.g., interferon-gamma).

The invention provides a traditional Chinese medicine preparation formula for treating sexual infectious diseases. The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 5-15 parts of coptis chinensis, 5-15 parts of scutellaria baicalensis, 5-15 parts of golden cypress, 5-15 parts of cape jasmine, 10-20 parts of honeysuckle, 10-20 parts of dandelion, 5-15 parts of chrysanthemum, 5-15 parts of philippine violet herb, 5-15 parts of gynura bicolor, 10-20 parts of houttuynia cordata, 5-15 parts of hairyvein agrimony, 5-15 parts of patrinia, 5-15 parts of fructus forsythiae, 10-30 parts of astragalus, 5-10 parts of divaricate saposhnikovia root, 5-15 parts of reed rhizome, 5-15 parts of salvia miltiorrhiza, 5-15 parts of poria cocos and 5-10 parts of curcuma zedoary. 5-15 parts of lucid ganoderma, 5-15 parts of bighead atractylodes rhizome and 5-10 parts of tendril-leaved fritillary bulb; according to the traditional Chinese medicine composition, large-dose heat-clearing and detoxifying medicines such as coptis chinensis, scutellaria baicalensis, golden cypress, honeysuckle and dandelion are used as monarch medicines, fructus forsythiae, houttuynia cordata and patrinia herb are used as auxiliary medicines, and the traditional Chinese medicine composition has broad-spectrum inhibition and killing effects on pathogens of various sexually transmitted diseases such as gonococcus, treponema pallidum, HSV, HPV, HIV and parasites, and can effectively control infection symptoms.

The invention provides a blood microorganism-based autism prediction model and application thereof, the prediction model takes blood microorganisms as markers, and the detection rate or relative abundance of the blood microorganisms is reduced; the risk that the blood sample suffers from autism is predicted by increasing the detection rate of blood microorganisms II or enhancing the relative abundance; the first blood microorganisms comprise ochrobactrum, pseudoalteromonas sp.3J6, rhodococcus equi, parabacteroides dieldrii, trichoderma harzianum, enterobacter hormaechei, wolbachia, yersinia enterocolitica, treponema pallidum and Elizabeth mosquito-repellent bacteria; the blood microorganisms II comprise Klebsiella compacticola and bdellovibrio bacteriovorus. According to the method, the model is constructed based on the blood metagenome data of 1946 standard autism four families, the advantages of blood microorganisms are brought into full play, disease signals are sensitively and accurately captured, the method can be applied to clinical autism prediction, and early risk assessment and layering of diseases are achieved.

The present invention provides compositions or vaccines that contain a recombinant or an attenuated Leptospira interrogans that elicit an immune response in animals against Leptospira infection, including compositions comprising said recombinant or attenuated L. interrogans, methods of vaccination against Leptospira, and kits for use with such methods and compositions.

The utility model discloses an MBBR (Moving Bed Biofilm Reactor) double-spiral-structure biological filler, which solves the technical problem that the local structure of the filler is easy to damage when the fillers collide with each other because the conventional filler does not have a buffering function. The ball comprises a ball body structure, a connecting ball arranged at the ball center of the ball body structure, and a plurality of elastic outer spiral bodies which are arranged on the connecting ball and are distributed in a radial mode. The elastic outer spiral bodies are distributed between the inner wall of the ball structure and the outer wall of the connecting ball. The elastic outer spiral body is composed of the two hemispheroid structures which are opposite to each other, the two hemispheroid structures are elastically connected, when a certain portion of the filler is impacted, the hemispheroid structure where the impacted portion is located moves and compresses the elastic outer spiral body, and other portions on the hemispheroid structures share impact force borne by the impacted portion together. And after the elastic outer spiral body is compressed and contracted, the movement of the hemispheroid structure is buffered, so that the local stress of the filler is prevented from being too large, and the local damage of the filler is prevented.

The present invention discloses a fistula implant, comprising: a spiral body and an expansion body connected to each other, one end of the spiral body being an implantation end and the other end being a connection end; the expansion body is a cone formed by a plurality of expansion sheets, the connection of the plurality of expansion sheets forming the proximal end of the expansion body, the connection end being fixedly connected to the proximal end and not intercommunication; the Young's modulus of the fistula implant is 400-3000MPa, the shear modulus is 150-1200Mpa, and the Poisson's ratio is 0.3-0.4. The present invention provides a fistula implant, which can ensure the blocking effect after implantation, prevent secondary leakage, and avoid the pain caused by blocking, thereby improving comfort.

The invention belongs to the technical field of biology, and discloses a method for determining a multivalent antigen sequence of an anti-periodontitis red complex, which comprises the following steps: firstly, screening out key virulence factor antigens (FimA-II, RgpA, Msp and BspA) from three core pathogenic bacteria of the red complex: porphyromonas gingivalis, treponema denticola and fusisterone; then, independently cloning each antigen gene to a pUC57 cloning vector, constructing a single antigen recombinant plasmid, and avoiding intergene interference by designing a specific enzyme cutting site; and finally, through plasmid transformation, positive clone screening and double enzyme digestion verification, the plasmid quality is ensured. The obtained single antigen plasmid can be flexibly combined and used, is beneficial to subsequent multivalent vaccine development, and has the advantages of wide antigen coverage, high expression reliability, flexible construction strategy, easiness in industrialization and the like.

The present invention relates to a vaccine comprising a non-replicating leptospira immunogen for use in the prophylactic treatment of a pig against infection by leptospira bacteria by injecting a first vaccine into the dermis of the pig.

Molecular probes for the diagnosis of Lyme borreliosis The invention relates to an aptamer which binds to the CspZ protein present on the surface of bacteria of the genus Borrelia and their use in an in vitro method for diagnosing an infection by a bacterium of the genus Borrelia in a subject.

The application provides an autism prediction model based on blood microorganisms and application thereof. The prediction model takes blood microorganisms as markers, and predicts the risk of autism of a blood sample through the decrease of a blood microorganism one detection rate or relative abundance, or the increase of a blood microorganism two detection rate or relative abundance. The blood microorganism one comprises Xanthobacteraceae bacterium, Pseudomonas sp.3J6, Rhodococcus equi, Parabacteroides distasonis, Xylella fastidiosa, Enterorhabdus hofmannii, Wolbachia, Yersinia enterocolitica, Borrelia parkeri and Elizabethkingia sp. The blood microorganism two comprises Klebsiella michiganensis and Bdellovibrio sp. The application constructs a model based on blood metagenomic data of 1946 standard four-generation families of autism, fully develops the advantages of blood microorganisms, sensitively and accurately realizes the capture of disease signals, and can be applied to the prediction of autism in the clinic, and realizes the early risk assessment and stratification of diseases.

The invention discloses an infectious disease marker composite quality control product as well as a preparation method and application thereof. The composite quality control product comprises the following components: a matrix liquid, 0.1-1 v / v% of a surfactant, 0.1-1 v / v% of a preservative, 1-5 g / L of a protein amino acid stabilizer, 1-10 g / L of trehalose, 1-10 g / L of (NH4) 2SO4 and five infectious disease markers including a hepatitis B virus surface antigen (HBsAg), a hepatitis B virus e antigen (HBeAg), a hepatitis C virus antibody (Anti-HCV), a human immunodeficiency virus antibody (Anti-HIV) and a treponema pallidum antibody (Anti-TP). The matrix liquid comprises 25-50 v / v% of human serum and a buffer solution. According to the invention, the five infectious disease markers are compounded, and the operation steps of a laboratory are reduced, so that the detection efficiency is improved, and the possibility of human errors is reduced. The composite quality control product can adapt to various mainstream detection instruments, meets the quality control requirements of different laboratories, and has strong market competitiveness.

The application discloses bacillus subtilis KC66, and also provides medical use of the strain in preventing and treating leptospirosis, and expands the medical range of the bacillus subtilis KC66. The application provides a new idea for preventing leptospirosis, can effectively reduce the abuse of antibiotics, and is helpful for the healthy development of the animal husbandry.