Systems and Methods to Quantify and Amplify Both Signaling and Probes for CDNA Chips and Gene Expression Microarrays

a technology of cdna chips and probes, applied in the field of detecting genes and gene expression from biological and medical samples, can solve the problems of ineffectiveness, inability to detect genes, and high cost of approach, and achieve the effect of improving diagnostic value and increasing signaling

Inactive Publication Date: 2009-11-05
GENETAG TECH
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This approach provides more accurate and sensitive detection of gene expression, enabling the analysis of rare transcripts and small samples, and overcomes biases in current methods by ensuring equivalent signaling per probe, thereby improving the quantification of gene expression frequencies.

Problems solved by technology

While it would be possible to make individual WRAP-PROBEs from single genes in a pool of mRNA products in the same manner as RT-PCR is applied to individually copy and amplify a single mRNA gene product and determine its presence, such an approach would be costly, inefficient and would introduce bias.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Systems and Methods to Quantify and Amplify Both Signaling and Probes for CDNA Chips and Gene Expression Microarrays
  • Systems and Methods to Quantify and Amplify Both Signaling and Probes for CDNA Chips and Gene Expression Microarrays
  • Systems and Methods to Quantify and Amplify Both Signaling and Probes for CDNA Chips and Gene Expression Microarrays

Examples

Experimental program
Comparison scheme
Effect test

example 1

Sample Molecular Compositions of the Present Invention

[0219]Universal GeneTAG Linkers:

[0220]1. Red 5′CTACGATACGATAGCGCCTAAGAGTAG (Seq. ID. No. 1) and its complement.

[0221]2. Green 5′CCTAGACCTACGACATAGGTACCCTAC (Seq. ID. No. 2) and its complement.

[0222]3. Blue 5′CGTAGAACTAGCACGCTACGTACTAGG (Seq. ID. No. 3) and its complement.

[0223]4. Orange 5′GGCTATCGCTACGTAGACTAGACCTAC (Seq. ID. No. 4) and its complement.

[0224]Modified Poly-T Primer with red or green universal linker and anchor end:

(Seq. ID. No. 1, 5)1. 5′CTACGATACGATAGCGCCTAAGAGTAG-TTTTTTTTTTTTTTTVN(Seq. ID. No. 2, 5)2. 5′CCTAGACCTACGACATAGGTACCCTAC-TTTTTTTTTTTTTTTVN

[0225]Double-Linker WRAP-Probe Set 1: Showing one probe strand with Red and Blue Universal Linkers, and with the variable target sequence indicated by S1 . . . Sn (Seq. ID. No. 1, 6)

[0226]5′CTACGATACGATAGCGCCTAAGAGTAG-S1 . . . Sn-CCTAGTACGTAGCGTGCTAGTTCTACG

[0227]Double-Linker WRAP-Probe Set 2: Showing one probe strand with Green and Orange Universal Linkers, and with th...

example 2

One-Linker WRAP-Probe Method

[0247]Total RNA is extracted from A549 lung cancer cells by standard methods. Reverse transcriptase (RT) is then employed to copy the mRNA transcripts to cDNA using a Modified poly-T Primer known as R-GT-RTP (Seq. ID. No. 8) having a 3′ end of 15 poly-T's and a 5′ end with a universal linker sequence that is similar to but differing in part from the Red Universal Linker of Example 1. For a comparative sample an alternative Modified poly-T Primer, known as G-GT-RTP (Seq. ID. No. 9) is used for the RT reaction to provide a second universal linker sequence wherein those sequences are also similar to but differing in part from the Green universal linker of Example 1.

[0248]The Examples 2 through 7 use these earlier versions of the red and green universal linkers in all their products, and thus the text of those Examples identifies them differently with the terms First-RED and First-GREEN in the descriptions to identify these sequence differences.

[0249]For a 25...

example 3

Double-linker WRAP-Probe Method with Restriction Cutting and Adapter Ligation

[0253]Total RNA was extracted from A549 lung cancer cells by standard methods. A 40 ug sample was treated with reverse transcriptase (RT) and a Modified Poly-T Primer to make ds cDNA copies of the mRNAs with a first linker, to cut and capture the end fragments, and to add a second linker by ligating an adapter. The following steps were employed to make the probes and perform a chip analysis:

[0254]1. Full length first strand cDNAs were made with one hour exposure to MuVL RT (Gibco) at 37 degrees C. using a Modified Poly-T Primer (Seq. ID. No. 16) having a 5′ biotin capture moiety, an overlap linker sequence and a poly-T segment. Nucleotides including Cy3-dCTP (AP Biotech) were incorporated as described above to provide “green” labeling.

[0255]2. Double stranded cDNA was made with E. coli DNA polymerase I, Rnase H and DNA ligase (Gibco kit) with a two hour exposure at 16 degrees C.

[0256]3. The ds cDNAs were tr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a series of reagent compositions and methods for making and amplifying novel cDNA based probe sets from RNA samples to improve analysis with gene expression arrays. The methods globally produce probe sets with common universal linkers at one or both ends, called WRAP-Probes, wherein the linkers do not bind to the target sequences and they can efficiently bind added reporters to the probes. The universal linkers are also designed as primer binding sites for copying and amplifying the probes, either linearly with one linker, or exponentially with double linkers. The capacity to globally and exponentially amplify the probe set by PCR is a primary advantage. Adding reporters by terminal linkers also improves quantification since each probe gets equivalent signaling. The invention allows expression analysis of small research, clinical and forensic samples to enable improved diagnostics, drug discovery, therapeutic monitoring, and medical, agricultural and general research.

Description

CROSS-REFERENCE TO RELATED PATENT APPLICATION[0001]This application claims the benefit, pursuant to 35 U.S.C. §119(e), of applicant's provisional U.S. Patent Application Ser. No. 60 / 187,982, filed Mar. 9, 2000, entitled “Methods to Quantify and Amplify Both Signaling and Probes for DNA Chips and Gene Expression Microarrays”, which is hereby incorporate by reference herein for all purposes. This application further is a continuation-in-part of, and claims the benefit, pursuant to 35 U.S.C. §120, of, applicant's U.S. patent application Ser. No. 09 / 744,097 filed Jan. 16, 2001 entitled “Methods for Detecting and Mapping Genes, Mutations and Variant Polynucleotide Sequences,” which is hereby incorporated by reference herein for all purposes and which is a National Stage Application of International Patent Application Serial No. PCT / US99 / 16242 filed Jul. 16, 1999.BACKGROUND OF INVENTION[0002]1. Field of Invention[0003]The present invention relates generally to the field of detecting genes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/68C07H21/04
CPCC07H21/04C12Q1/68C12Q2521/107C12Q2525/155C12Q2525/161
InventorSHAFER, DAVID A.
OwnerGENETAG TECH