Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant swine influenza virus and uses thereof

a technology of swine flu virus and recombinant swine flu, which is applied in the field of recombinant swine flu virus and immunogenic composition and methods, can solve the problem that current siv vaccines do not provide cross-protection against multiple antigenic siv variants

Inactive Publication Date: 2013-07-25
UNIVERSITY OF SASKATCHEWAN
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention is about creating chimeric influenza viruses that have been altered to have the neuraminidase (NA) from different subtypes of swine influenza viruses (SIVs). These chimeric viruses can be used as live, attenuated vaccines that can provide broad coverage against a number of influenza strains. The chimeric viruses can grow efficiently in culture and are attenuated in pigs as no sialidase is present in swine. The NA packaging signals are largely retained for efficient packaging. The technical effect is the creation of a safe and effective live, attenuated vaccine that can protect against influenza virus infection.

Problems solved by technology

Current SIV vaccines do not provide cross-protection against multiple antigenic SIV variants.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant swine influenza virus and uses thereof
  • Recombinant swine influenza virus and uses thereof
  • Recombinant swine influenza virus and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Generation of a Recombinant Virus Including Both H1 and H3 HAs

[0160]A recombinant, chimeric influenza A virus possessing, an eight segmented genome, was produced as detailed below. The virus included seven segments of a swine H1N1 virus with the majority of the NA segment replaced by an H3 HA coding region sequence flanked by NA packaging sequences. The virus thus included HAs from two different types of swine influenza, H1 HA and H3 HA. Because NA is essential for virus propagation, the function of NA was provided by growing the virus in the presence of sialidase (neuraminidase).

[0161]In particular, in order to generate a recombinant swine influenza virus carrying two different HA molecules, the NA segment in an H1N1 swine influenza virus, A / swine / Saskatchewan / 18789 / 02, termed “SIV SK02” herein (obtained from the Prairie Diagnostic Services, Western College of Veterinary Medicine, University of Saskatchewan, Canada) was replaced with an H3 HA segment from the H3N2 Influenza A virus...

example 2

Characterization of SIV / SK-606

[0164]To confirm that recombinant virus SIV / SK-606 possessed both H1 and H3 HA segments in its genome, viral RNA was isolated from purified virons. Briefly, tissue culture grown viruses were collected by ultracentrifugation and subjected to a sucrose gradient centrifugation (Masic et al., J. Gen. Virol. (2009) 90:375-385). For RNA purification, purified virions were processed following manufacturer's instruction of Trizol (Invitrogen). Reverse transcription was performed using the Uni12 primer (Hoffman et al., Arch. Virol. (2001) 146:2275-2289) which specifically amplifies viral RNAs. PCR was carried out by using primers specific for H1 (Fw 5′ TGGCCAAACCATGAGACAAC 3′ (SEQ ID NO:27) and Bw 5′ GGCGTTATTCCTCAGTTGTG 3′ (SEQ ID NO:28)) and H3 HAs (Fw 5′ CGCAATCGCAGGTTTCATAG 3′ (SEQ ID NO:29) and Bw 5′ CAACCCAGAAGCAAGGCCTCAATCTTTGTATCCTGATTTCAGC 3′ (SEQ ID NO:30)).

[0165]While PCR products representing the H1 HA segment were detected only in the SK02 and the S...

example 3

Pathogenicity of SIV-606 in Pigs

[0170]The pathogenicity of SIV-606 was evaluated in pigs. Thirty-five 4-week old SIV-negative pigs were split randomly into seven groups of five pigs. These were infected intratracheally with 4 ml MEM containing 1×105 or 1×106 PFU / ml SK02 WT, SIV-606 or Tx98. The animals in the control group were mock infected with medium only (Table 1). Rectal temperature was monitored daily. On day 5 post infection pigs were euthanized and necropsies were performed. As shown in FIGS. 3A-3C, pigs infected with wild-type viruses had an increased temperature on day 1 post infection, and the temperature decreased gradually on the following days. However, pigs infected by SIV-606 did not show elevated temperatures compared to the control group. At necropsy, the macroscopic lung lesions were documented. The mock, SIV-606 high dose- and low dose-infected pigs did not show any typical macroscopic lung lesions. In contrast, gross lesions characterized as purple- to plum-colo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
w/waaaaaaaaaa
diameteraaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

Recombinant, chimeric porcine influenza viruses are disclosed that include hemagglutinin segments from more than one influenza virus subtype. Also described are methods of producing the recombinant influenza viruses, immunogenic compositions comprising the recombinant influenza viruses, methods of stimulating an immune response against influenza virus, and methods of treating and preventing influenza virus infection.

Description

CROSS-REFERENCE TO RELATED APPLICATION[0001]This application claims the benefit under 35 U.S.C. §119(e)(1) to U.S. Provisional Application No. 61 / 514,156, filed Aug. 2, 2011, which application is incorporated herein by reference in its entirety.TECHNICAL FIELD[0002]The present invention pertains generally to influenza virus and immunogenic compositions and methods for treating and preventing influenza infection. In particular, the invention relates to recombinant, chimeric swine influenza viruses expressing more than one hemagglutinin (HA) subtype.BACKGROUND[0003]Swine influenza (SI) is an acute respiratory disease of swine caused by type A and type C influenza viruses. Influenza A viruses are segmented negative-strand RNA viruses and can be isolated from a number of other animal host species, including birds, humans, horses, whales, and mink. Although whole influenza viruses rarely cross the species barrier, gene segments can cross this barrier through the process of genetic reasso...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): A61K39/145
CPCA61K39/145C12N2760/16134C12N2799/025A61K2039/5254A61K2039/544A61K2039/552A61K2039/70C12N2760/16162C12N2760/16171C12N7/00A61K39/12C12N15/85C12N2760/16152C12N2760/16121C12N2800/107A61P31/16A61P37/04C12N2760/16151
Inventor ZHOU, YANMASIC, ALEKSANDAR
Owner UNIVERSITY OF SASKATCHEWAN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com