DNA sequence that increases odorant receptor representation in the olfactory system

a technology of odorant receptors and dna sequences, which is applied in the field of genetically modified organisms with an increased representation of odorant receptors, can solve the problems of limited success in odor profiling or heterologous cell expression in vitro, many in vitro characterized or alleles may not be functional in an in vivo setting, and high cost of us

Pending Publication Date: 2020-03-26
RES FOUND THE CITY UNIV OF NEW YORK
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This approach significantly increases the sensitivity to cognate odors, allowing for enhanced odor detection and improved behavioral responses, enabling researchers to study odorant receptor gene choice, axon identity, and odor coding in vivo, and facilitating high-throughput screening for odorant ligands.

Problems solved by technology

Currently, animals such as dogs, bees and rats are deployed to help humans with scent detection tasks, but their use is expensive since they require long-term training.
There has been limited success in odor profiling ORs expressed in heterologous cells in vitro.
Part of this limitation is due to the inability of OR proteins to traffic to the plasma membrane.
In addition, given the biological properties of the olfactory system many in vitro characterized OR alleles may not be functional in an in vivo setting.
The major drawback, though, has been the ability to rapidly contrast how odors presented in liquid phase (in vitro) correspond to odors presented to the OR in vapor phase within their mucosal environment (in vivo).
In addition, the study of both OR gene choice and OR coding in vivo is hampered by the low representation of a given OR, i.e. only ˜0.1% on average of the total neuronal population in a wild type mouse.
Unfortunately, no suitable in vivo approach is known.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA sequence that increases odorant receptor representation in the olfactory system
  • DNA sequence that increases odorant receptor representation in the olfactory system
  • DNA sequence that increases odorant receptor representation in the olfactory system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019]This disclosure pertains to a method of controlling the expression of specific odorant receptors in vivo in mice by multimerizing a specific 21 bp sequence encompassing the homeodomain binding site sequence, TAATGA, known to be a determinant in OR gene choice and adding it to the M71 odorant receptor (OR) transgene backbone (see Rothman et al. The Promoter of the mouse odorant receptor gene M71; Mol. Cell. Neurosci. 28, 535-546, 2005). Of note, the 21 bp sequence was chosen to reflect two complete turns of double stranded B-DNA (10.5 bp per turn on average). The method reproducibly and dramatically increases the total number of olfactory sensory neurons (OSNs) expressing specific mouse or human OR coding sequences in different transgenic animals. The transgenic vector was designed in such way that any odorant receptor or G-protein-coupled receptors (GPCR) (human, mouse or from any species), can be shuttled into the transgenic backbone. Importantly, proof of concept studies sho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application claims priority to and is a continuation of U.S. patent application Ser. No. 15 / 749,007 (filed Jan. 30, 2018) which is U.S. national stage filing under 35 U.S.C. 371 of PCT / US16 / 45338 (filed Aug. 3, 2016) which claims priority to U.S. Patent Application 62 / 200,312 (filed Aug. 3, 2015) and 62 / 312,068 (filed Mar. 23, 2016) the entirety of which are incorporated herein by reference.STATEMENT OF FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT[0002]This invention was made with government support under grant number GM088114-01A1 awarded by the National Institute of Health and grant number MD007599 awarded by the National Institute on Minority Health and Health Disparities. The government has certain rights in the invention.REFERENCE TO A SEQUENCE LISTING[0003]This application contains a Sequence Listing in computer readable form. The computer readable form is incorporated herein by reference.BACKGROUND OF THE INVENTION[0004]The sub...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A01K67/027C12N15/85
CPCA01K67/0275A01K2267/02A01K2227/10C12N15/8509A01K2217/072A01K2217/20C12N15/85
InventorFEINSTEIN, PAULD'HULST, CHARLOTTE
OwnerRES FOUND THE CITY UNIV OF NEW YORK