Method for the production of polyunsaturated fatty acids

A technology for unsaturated and desaturase enzymes, applied in the field of specific production of polyunsaturated omega-3 and omega-6 fatty acids, which can solve problems such as insufficient, difficult separation and characterization

Inactive Publication Date: 2008-08-20
UNIV OF BRISTOL
View PDF45 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, to date, the various desaturases have only been insufficiently characterized biochemically due to the great difficulty of isolating and characterizing the enzymes in the form of membrane-bound proteins (McKeon et al., Methods in Enzymol )71, 1981: 12141-12147, Wang et al., Plant Physiol. Biochem., 26, 1988: 777-792)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for the production of polyunsaturated fatty acids
  • Method for the production of polyunsaturated fatty acids
  • Method for the production of polyunsaturated fatty acids

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0157] Example 1: General Cloning Method

[0158]Cloning methods such as restriction enzyme digestion, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and Nile membranes, ligation of DNA fragments, transformation of Escherichia coli, cultivation of bacteria, and preparation of recombinant DNA Sequence analysis was performed as described by Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6).

Embodiment 2

[0159] Example 2: Sequence Analysis of Recombinant DNA

[0160] Sequencing of the recombinant DNA molecules was carried out by the Sanger method (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA74, 5463-5467) with a laser fluorescence DNA sequencer from the company ABI. The PCR-generated fragments were sequenced and checked to avoid polymerase errors in the construct to be expressed.

Embodiment 3

[0161] Example 3: Cloning of the delta-8-desaturase (=SEQ ID NO: 1 ) from Euglena pumilus

[0162] PCR amplification was performed using cDNA from Euglena minutis strain Z as template. cDNA synthesis was from total RNA extracted from cultures of E. gracilis strain Z. Unique primers for the start methionine and stop codon of Euglena delta-8-desaturase were synthesized as follows, including restriction sites.

[0163] Primer 1: EDELTA8BamF

[0164] ATGGATCCACCATGAAGTCAAAGCGCCAA

[0165] Primer 2: EDELTA8XhoR

[0166] ATCTCGAGTTATAGAGCCTTTCCCCGCGC

[0167] PCR protocol

[0168] Annealing temperature: 45°C for 1 minute

[0169] Denaturation temperature: 94°C for 1 minute

[0170] Extension temperature: 72°C for 2 minutes

[0171] Number of cycles: 30

[0172] The PCR product was separated on an agarose gel to obtain a 1270 bp fragment. The PCR fragment was cloned into pGEM-T easy vector (Promega) and the insert was sequenced. This revealed the presence of an open readin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to an improved process for the specific production of poly-unsaturated omega-3 and omega-6 fatty acids and a process for the production of triglycerides having an increased content of unsaturated fatty acids, in particular omega-3 and omega-6 fatty acids having at least two double bonds and a 20 or 22 carbon atom chain length. The invention relates to the produc-tion of a transgenic organism, preferably a transgenic plant or a transgenic microorganism, hav-ing an increased content of fatty acids, oils or lipids containing C20- or C22- fatty acids with a delta-5, 7, 8, 10 double bond, respectively due to the expression of a delta-8-desaturase and a delta-9- elon-gase from organisms such as plants preferably Algae like Isochrysis galbana or Euglena gracilis. In addition the invention relates to a process for the production of poly unsaturated fatty acids such as Eicosapentaenoic, Arachidonic, Docosapentaenoic or Docosahexaenoic acid through the co- expression of a delta -8-desaturase, a delta-9-elongase and a delta-5 desaturase in organisms such as microorganisms or plants.The invention additionally relates to the use of specific nucleic acid sequences encoding for the aforementioned proteins with delta-8-desaturase-, delta-9-elongase- or delta-5-desaturase-activity, nucleic acid constructs, vectors and organisms containing said nucleic acid sequences. The invention further relates to unsaturated fatty acids and triglycerides having an increased content of at least 1 % by weight of unsaturated fatty acids and use thereof.

Description

field of invention [0001] The present invention relates to an improved process for the specific production of polyunsaturated omega-3 and omega-6 fatty acids; and a process for the production of triglycerides with an increased content of unsaturated fatty acids, wherein said unsaturated fatty acids, inter alia, have at least two double bonds and 20 Or omega-3 and omega-6 fatty acids with a chain length of 22 carbon atoms. The present invention relates to the production of transgenic organisms, preferably transgenic plants or transgenic microorganisms, comprising C with Δ-5, 7, 8, 10 double bonds, respectively 20 - or C 22 - Increased content of fatty acids, oils or lipids, including fatty acids, which can be attributed to the expression of Δ8-desaturases and Δ9-elongases from organisms such as plants, preferably algae such as Isochrysis green light or Euglena minutis. In addition, the present invention also relates to the production of eicosapentaenoic acid, peanut Methods...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/82C12P7/64C12N9/10
InventorJ·A·内皮尔O·萨亚诺娃C·M·拉扎勒斯B·齐E·海因茨T·灿克U·策林格
OwnerUNIV OF BRISTOL