Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation of N-aceto-D-neuraminic acid by N-aceto-D-neuraminic acid aldonase immobilizing method

A neuraminic acid aldolase and neuraminic acid technology, applied in the direction of immobilized enzymes, biochemical equipment and methods, enzymes, etc., can solve the problems that are not conducive to the separation of products, enzymes are not stable without immobilized enzymes, and have low efficiency

Inactive Publication Date: 2009-03-11
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current enzymatic preparation of Neu5Ac generally uses bacterial cells or crude enzymes. The enzymes in this method are not as stable as immobilized enzymes and cannot be reused. Moreover, the reaction takes a long time and the efficiency is low.
In addition, the use of cells or crude enzymes for transformation is not conducive to the isolation of products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation of N-aceto-D-neuraminic acid by N-aceto-D-neuraminic acid aldonase immobilizing method
  • Preparation of N-aceto-D-neuraminic acid by N-aceto-D-neuraminic acid aldonase immobilizing method
  • Preparation of N-aceto-D-neuraminic acid by N-aceto-D-neuraminic acid aldonase immobilizing method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0044] 4. Preparation of Neu5Ac

[0045] After the N-acetyl-D-neuraminic acid aldolase immobilized enzyme is prepared as above, it can be contacted with the substrate N-acetylmannosamine and pyruvate or its salt, under conditions suitable for the catalytic activity of the enzyme Neu5Ac was prepared as follows.

[0046] Usually the reaction is carried out at a temperature of 20-30°C, preferably, the temperature is 22-30°C. In a preferred embodiment, the temperature is 28°C. The speed is usually 120-180 rpm.

[0047] Water is generally used to prepare solutions of pyruvate or its salts and N-acetylmannosamine. Of course, other solvents can also be used for formulation. Useful solvents are well known to those skilled in the art.

[0048] In addition, the method for measuring enzyme activity of the present invention is also well known in the art. For example, the methods for measuring enzyme activity used in the present invention include:

[0049] (1) Dilute a certain amoun...

Embodiment 1

[0064] Example 1 : Acquisition of N-acetylneuraminic acid aldolase (E.C.4.1.3.3) gene from total DNA of E.coli TG1 and construction of recombinant plasmid pNA1

[0065] Use the following primers

[0066] 1: 5'gacgctaccatggcaacgaatttacgt 3'

[0067] 2: 5'gatccagtcgactcgcccgcgctcttg 3'

[0068] Using the total DNA of E.coli TG1 as a template, PCR amplification was carried out. After the PCR, the recovered 0.9kb fragment was acidified, cloned into the pUC118 plasmid digested by HincII, named pNA, and transformed into E.coli DH5α. state cells. Recombinants were selected by X-gal blue and white spots, and positive recombinants were identified by enzyme digestion.

[0069] with the following primers

[0070] 1: 5' ggaattccatatggcaacgaatttacgtggcg 3'

[0071] 2: 5' cgggatcctcacccgcgctcttgcatc 3'

[0072] As a primer, use the plasmid pNA as a template to carry out PCR amplification. After the PCR, the recovered 0.9kb fragment is double digested with Nde I and BamH I and cloned...

Embodiment 2

[0073] Example 2 : Fermentation of engineering bacteria BL21(DE3) / pNA1 and preparation of N-acetylneuraminic acid aldolase affinity carrier (Agar) immobilized enzyme

[0074] Use 3L TB culture medium (to prepare broth for every increase in concentration, add in 900ml deionized water: 12g of peptone for bacterial culture; 24g of yeast extract for bacterial culture; 4ml of glycerol. Autoclave for 20 minutes, then cool the solution to 60°C or below, then add 100ml of sterilized 0.17mol / LKH 2 PO 4 , 0.72mol / L K 2 HPO 4 Solution) Ferment engineering bacteria BL21(DE3) / pNA1 in a 5L fermenter. After culturing at 37°C for about 1h, add lactose with a final concentration of 1% to induce, and at the same time lower the temperature to 22°C, and add a final concentration of 0.5 % lactose induction, fermented for about 20 hours, closed the tank, centrifuged at 8000rpm for 10 minutes to collect the bacteria.

[0075]Weigh 10g of BL21(DE3) / pNA1 fermented for 20h, add 20ml of 0.5M pH7.5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to produce the N-acetyl neuraminic acid by the N-acetyl-D-neuraminic acid aldolase immobilized enzyme. The process immobilizes the N-acetyl-D-neuraminic acid aldolaseby the affinity carrier using the N-acetyl glucosamine and the pyruvic sodium as the substrate.

Description

technical field [0001] The present invention relates to a novel N-acetyl-D-neuraminic acid aldolase, its immobilized enzyme, and the use of the immobilized enzyme to prepare and convert N-acetylmannosamine and sodium pyruvate to obtain N-acetylneuraminic acid (Neu5Ac) method. Background technique [0002] Sialic acid is an acidic amino sugar with 9 carbon atoms and a pyranose structure. Neu5Ac is the main representative of sialic acid. This kind of compound can bind to the terminal positions of glycoproteins and glycolipids, and play a very important role in the process of biological recognition. For example, during the process of influenza virus infecting host cells, the sialidase of influenza virus can recognize N-acetylneuraminic acid and its derivatives, and bind to sialic acid to infect cells and release the replicated virus. If its sialidase is inhibited, then the disease caused by the virus can be treated. According to the structure of sialic acid, design its anal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12P19/26C12N11/00
Inventor 陈军饶娆杨蕴刘胡世元邵丽君杨晟姜卫红白骅杨仲毅王海彬
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI