Recombinant target fusion protein GnRH-TNFam and its antitumor use
A fusion protein and targeting technology, which is applied in the direction of anti-tumor drugs, recombinant DNA technology, drug combination, etc., can solve the problems of high toxicity and side effects, poor specificity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1. Acquisition of the gene GnRH-TNFαm encoding the recombinant targeting fusion protein
[0043] 1.PCR primers and their sequences
[0044] Pvt3: 5'-TT CCGCCACCGGCCGTACCGGGTCCAAGATCA-3'
[0045] EcoRI
[0046] Pvt4: 5'-TAT CAGGGCAATGAT-3'
[0047] BamHI Stop codons
[0048] Pgt1: 5'-AAA CAGCACTGGTCCTATGGTCTGCGCCCTGGC CC GCCACCG-3'
[0050] Pgt2: 5'-AAA CAGCACTGGTCCCATGGTTGGTGTCCGGGC CCGCCACCG-3'
[0052] 2. Acquisition of mutant TNFα cDNA (TNFαm)
[0053] The recombinant plasmid pLT9KGITNFαm ( figure 1 ) was specifically amplified to obtain the cDNA of mutant TNFα (TNFαm). As a result, an EcoRI site ( ) and codons for several additional amino acids GTA AGA TCA (underlined in bold). The amino acid sequence corresponding to this coding sequence is: Val Arg Ser. At the same time, two stop codons ( ) and a BamHI site ( ). In order to confirm that the obtained DNA fragment was the expec...
Embodiment 2
[0056] Example 2. Construction of fusion gene GnRH-TNFαm temperature-controlled expression recombinant pLTEGTI
[0057] In order to express the fusion gene GnRH-TNFαm into the fusion protein GnRH-TNFαm in E.coli, it will be cloned into the NdeI / BamHI of the E.coli expression vector pCW111 constructed in this laboratory, so as to set its expression Under the control of the temperature-regulated promoter PRPL. The construction process is as follows: carry out NdeI / BamHI double enzyme digestion on pLTSKGTI, recover the fusion gene GnRH-TNFαm fragment, and then connect it with the expression vector pCW111 treated in the same way, so as to obtain the temperature-controlled expression recombinant pLTEGTI of the fusion gene GnRH-TNFαm ( Figure 5 ). The identification results of the enzyme digestion map were in line with expectations.
Embodiment 3
[0058] Example 3. Construction of the IPTG-inducible expression vector pLT30GTI of the fusion gene GnRH-TNFαm
[0059] The construction process of pLT30GTI is as follows: carry out NdeI / BamHI double enzyme digestion on pLTSKGTI, recover the fusion gene GnRH-TNFαm fragment, and then connect it with the expression vector pET30 treated in the same way, so as to obtain the IPTG-inducible expression recombinant of the fusion gene GnRH-TNFαm pLT30GTI ( Figure 6 ). The identification results of the enzyme digestion map were in line with expectations.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
