Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant target fusion protein GnRH-TNFam and its antitumor use

A fusion protein and targeting technology, which is applied in the direction of anti-tumor drugs, recombinant DNA technology, drug combination, etc., can solve the problems of high toxicity and side effects, poor specificity, etc.

Inactive Publication Date: 2009-07-22
THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] In summary, (1) TNFα has a good potential for development and application—it is the cytokine with the strongest anti-tumor activity known, but it cannot be applied because of poor specificity and large toxic and side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant target fusion protein GnRH-TNFam and its antitumor use
  • Recombinant target fusion protein GnRH-TNFam and its antitumor use
  • Recombinant target fusion protein GnRH-TNFam and its antitumor use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1. Acquisition of the gene GnRH-TNFαm encoding the recombinant targeting fusion protein

[0043] 1.PCR primers and their sequences

[0044] Pvt3: 5'-TT CCGCCACCGGCCGTACCGGGTCCAAGATCA-3'

[0045] EcoRI

[0046] Pvt4: 5'-TAT CAGGGCAATGAT-3'

[0047] BamHI Stop codons

[0048] Pgt1: 5'-AAA CAGCACTGGTCCTATGGTCTGCGCCCTGGC CC GCCACCG-3'

[0049] NdeI EcoRI

[0050] Pgt2: 5'-AAA CAGCACTGGTCCCATGGTTGGTGTCCGGGC CCGCCACCG-3'

[0051] NdeI EcoRI

[0052] 2. Acquisition of mutant TNFα cDNA (TNFαm)

[0053] The recombinant plasmid pLT9KGITNFαm ( figure 1 ) was specifically amplified to obtain the cDNA of mutant TNFα (TNFαm). As a result, an EcoRI site ( ) and codons for several additional amino acids GTA AGA TCA (underlined in bold). The amino acid sequence corresponding to this coding sequence is: Val Arg Ser. At the same time, two stop codons ( ) and a BamHI site ( ). In order to confirm that the obtained DNA fragment was the expec...

Embodiment 2

[0056] Example 2. Construction of fusion gene GnRH-TNFαm temperature-controlled expression recombinant pLTEGTI

[0057] In order to express the fusion gene GnRH-TNFαm into the fusion protein GnRH-TNFαm in E.coli, it will be cloned into the NdeI / BamHI of the E.coli expression vector pCW111 constructed in this laboratory, so as to set its expression Under the control of the temperature-regulated promoter PRPL. The construction process is as follows: carry out NdeI / BamHI double enzyme digestion on pLTSKGTI, recover the fusion gene GnRH-TNFαm fragment, and then connect it with the expression vector pCW111 treated in the same way, so as to obtain the temperature-controlled expression recombinant pLTEGTI of the fusion gene GnRH-TNFαm ( Figure 5 ). The identification results of the enzyme digestion map were in line with expectations.

Embodiment 3

[0058] Example 3. Construction of the IPTG-inducible expression vector pLT30GTI of the fusion gene GnRH-TNFαm

[0059] The construction process of pLT30GTI is as follows: carry out NdeI / BamHI double enzyme digestion on pLTSKGTI, recover the fusion gene GnRH-TNFαm fragment, and then connect it with the expression vector pET30 treated in the same way, so as to obtain the IPTG-inducible expression recombinant of the fusion gene GnRH-TNFαm pLT30GTI ( Figure 6 ). The identification results of the enzyme digestion map were in line with expectations.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel recombination targeting fusion protein GnRH-TNF alpham which is integrated from gonadotrophin releasing hormone (GnRH-A) and recombinant mutant human tumor necrosis factor alpha (TNF alpha), the targeting fusion protein has destroying action to the tumor cells endured by the prototype TNF alpha. The invention also provides the DNA sequence of the recombinant target fusion protein GnRH-TNFam and its expression recombinants.

Description

technical field [0001] The present invention relates to the field of genetically engineered protein drugs, more specifically, the present invention relates to a gene encoding a novel recombinant targeted anti-tumor drug fusion protein GnRH-TNFαm, an expression-type recombinant containing the gene, and a gene containing the expression-type recombinant The engineering bacteria, the targeting fusion protein GnRH-TNFαm expressed and isolated by the engineering bacteria, and the specific killing effect of the targeting fusion protein on a class of malignant tumor cells. Background technique [0002] Although the techniques and means of early diagnosis of malignant tumors, surgery, radiotherapy and chemotherapy have made considerable progress in recent years, and the combination of surgery and radiotherapy and chemotherapy for patients with early malignant tumors can also achieve good results. For those patients with advanced malignant tumors without indications for surgery, they ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N1/21C12P21/00A61K38/22A61P35/00
Inventor 卢圣栋李涛
Owner THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com