Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing swine N-acetglutamic acid synthetase polyclonal antibody and application thereof

An acetylglutamic acid, polyclonal antibody technology, applied in the direction of recombinant DNA technology, anti-enzyme immunoglobulin, DNA/RNA fragments, etc. Problems such as insufficient synthesis of acetylglutamic acid

Inactive Publication Date: 2009-12-02
印遇龙
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the small intestinal mucosa and mitochondria of the liver of suckling piglets, the lack of N-acetylglutamic acid synthetase leads to insufficient synthesis of N-acetylglutamic acid, thereby reducing the synthesis of intestinal citrulline and arginine, resulting in lactation Arginine deficiency in piglets
Although adding arginine to milk replacement diets for suckling piglets can greatly improve their performance, it is not suitable for actual pig production due to the high cost of fully automatic artificial feeding systems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing swine N-acetglutamic acid synthetase polyclonal antibody and application thereof
  • Method for preparing swine N-acetglutamic acid synthetase polyclonal antibody and application thereof
  • Method for preparing swine N-acetglutamic acid synthetase polyclonal antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0022] 1 Gene cloning: take fresh healthy pig liver tissue, use RNA extraction kit, and extract total RNA according to the conventional guanidine isothiocyanate method. Primers were designed and synthesized according to the gene sequence of porcine NAGS cloned for the first time (GenBank accession number EF429095). Forward primer: 5'ATGGACATGAAGCCCTCTGGT GG3'; reverse primer: 5'TCAGCTGCCTGGGTCAGAAGCC 3'. Using the total RNA of pig liver as a template, use the above primers to amplify the coding sequence of the pig NAGS gene by RT-PCR, and its full length is 1107bp , for the nucleotide sequence see figure 2 .

[0023] 2 Construction of recombinant plasmid pLM1-NAGS:

[0024] Design and synthesize primers according to the gene sequence of porcine NAGS:

[0025] NAGS F: 5'-CGCGC GAATTC AGGAGGAATTTAAAATGAGAGGATCG CATCACCATCACCATCAC GACATGAAGCCTCTGGTGGTTCTGGGGCTG-3';

[0026] NAGSR: 5'-CTGCAG GTC GAC TCATTCAGCTGCCTGGGTCAGAAGCCG-3'.

[0027] Among them, the restriction si...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method and application of a porcine N-acetylglutamate synthase polyclonal antibody. The steps are: cloning porcine NAGS gene, designing and synthesizing primers according to the gene sequence, and expressing the obtained full-length porcine The recombinant prokaryotic expression plasmid pLM1-NAGS of N-acetylglutamic acid synthase was transformed into Escherichia coli BL21; the BL21 of the transformed recombinant plasmid was cultured to an OD value of 0.4; IPTG 0.2mM was added to the cultured Escherichia coli BL21 to induce; The induced bacteria were collected by centrifugation, resuspended with PBS, lysed by adding lysozyme, and then sonicated. N-acetylglutamate synthase was used as an antigen to immunize Japanese large-eared white and black-eyed rabbits to obtain polyclonal antibody to N-acetylglutamate synthase, which was enhanced with incomplete Freund's adjuvant; the corresponding antiserum was obtained. The invention can detect the changes of distribution and expression activity of NAGS in suckling piglets at different developmental stages.

Description

technical field [0001] The invention relates to a preparation method and application of a porcine N-acetylglutamate synthetase polyclonal antibody. Background technique [0002] It has long been believed that pig milk can provide sufficient amino acids to meet the growth needs of suckling piglets, but research in recent years has shown that when pig milk is the only source of dietary protein for piglets, suckling piglets cannot grow optimally Performance, the research results show that the supply of arginine in breast milk and the endogenous synthesis of arginine in piglets at the age of 7-21 days is one of the main factors that limit the optimal growth of piglets, so increasing the supply of arginine in suckling piglets has Helps to maximize the growth potential of newborn piglets. [0003] N-acetylglutamate (NAG) is an allosteric activator of the first synthetase carbamoyl phosphate synthetase (CPSI) in the endogenous synthesis pathway of arginine (Adadjieva et al., 2001)...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/52C12N15/70C07K16/40G01N33/573
Inventor 印遇龙黄瑞林储武英
Owner 印遇龙