Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting polyploidy plant gene mononucleotide site mutation

A single nucleotide and point mutation technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of false positive detection, low efficiency, time-consuming, etc., and achieve good detection of point mutations, easy operation, The effect of easy method

Inactive Publication Date: 2007-10-17
WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Disadvantages of PCR-SSCP technology: there are false positives in the detection, the size of the analysis fragment is limited, it is strongly dependent on the choice of experimental conditions, and mutations may be missed
[0004] The above methods all have higher cost, time-consuming, less efficient than the EcoTILLING method and the SuperEcoTILLING method of the present invention

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting polyploidy plant gene mononucleotide site mutation
  • Method for detecting polyploidy plant gene mononucleotide site mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0021] A method for detecting single nucleotide point mutations in polyploid plant genes, the specific steps of which are as follows:

[0022] 1. The material used is a paddy field weed with a multi-gene system. DNA extraction kit (QIAGEN-DNeasy Plant Mini Kit) was used to extract total DNA from a polyploid weed with a polygenic system: Cosmos miltiorrhiza;

[0023] 2. Design its multi-gene system (ALS1, ALS2, ALS3 and ALS4, according to Wang et al., Discovery of single-nucleotide mutations in acetolactate synthase genes by EcoTILLING, Pestic.Biochem.Physiol.(2006), doi: 10.1016 / j A pair (two) primers (the sequences of which are respectively:

[0024] TCTGCATCGCCACCTCG and TGAAGCAGATGGAGG GCAGG) for FirstPCR amplification (the two primers were labeled with 700nm and 800nm ​​fluorescent dyes, respectively, and the labeling sequences were gctacggactgacctcggac and ctgacgtgatgctcctgacg). That is, the sequence of the forward primer is: gctacggactgacctcggacTCTGCATCGCCACCTCG, and t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a method for detecting single- nucleotide site mutation of polypoid plant. The steps are: using multiple gene system paddy field weed Monochoria vaginalis, selecting ALS1 gene and ALS3 gene, extracting total DNA, PCR amplification using primer only specific to two target gene ALS1and ALS3, denaturalizing ,annealing, obtaining heterologous double-chain nucleic acid molecule, shearing heterologous double-chain nucleic acid using endonuclease with specific recognition function and cutting mis-matched base, denaturalizing and proceeding double-color polyacrylamide gel electrophoresis and obtaining two maps. When individual is variant, designing primer and screening, detecting mutant gene and sequencing for test, if variance is not detected, it is wild type. The present method is practical , reproduceable and easily operated, and has good effect on detecting point mutation.

Description

technical field [0001] The present invention relates to the field of detection of single nucleotide point mutations in genes produced by polyploid plants under natural conditions, and more specifically relates to a detection of polyploid plant gene nucleotide points with a multigene system (multigene system) method of mutation. When developing DNA markers, it is important to be able to detect DNA variants quickly. However, most of the DNA sequencing methods used in the past not only require a lot of labor, but also cost a lot. The invention can quickly detect a large number of SNPs (Single Nucleotide Polymorphism), and can also be applied to the identification of polyploid varieties with polygene systems. Background technique [0002] At present, there are some methods for detecting single nucleotide point mutations in plant genes at home and abroad, such as: PCR-single-strand conformation polymorphism analysis (PCR-SSCP), PCR-denaturing gradien...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 汪光熙李伟
Owner WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com