Bivalent expression carrier for culturing anti-glyphosate plants

An expression vector, glyphosate technology, applied in the direction of plant genetic improvement, botany equipment and methods, use of vectors to introduce foreign genetic material, etc., can solve the problem of lower crop yield, unsatisfactory glyphosate resistance effect, impact on Problems such as plant reproduction and development, to improve the ability to resist glyphosate and avoid negative effects

Active Publication Date: 2008-01-09
LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the anti-glyphosate effects of the above two methods are not very satisfactory. For example, glyphosate accumulates in plants, especially meristems (Gougler&Geiger, 1981), which will affect plant reproductive development and reduce crop yield (Pline et al. ., 2002)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bivalent expression carrier for culturing anti-glyphosate plants
  • Bivalent expression carrier for culturing anti-glyphosate plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] The construction of embodiment 1 bivalent plant expression vector

[0054] 1) Using pGAT plasmid as template, with 5'G CTCGAG ATGATTGACGTGAACCCAAT 3' and 5'G GTTAAC TTATGCGATCCTCTTGTACA 3' is a primer (adding XhoI and hpaI sites) to amplify by PCR to obtain gene fragments with XhoI and hpaI restriction sites at both ends, and connect to the T-vector;

[0055] 2) The ligation product in 1) was transformed into Escherichia coli DH5α, and a positive clone was selected and named as pGAT-T;

[0056] 3) The p4A and pSK plasmids were digested by KpnI and HindIII, and the 1.4kb and 2.7kb DNA bands were recovered respectively. After ligation, they were transformed into E. coli DH5α, and the positive clones were selected and named pSK4A;

[0057] 4) The pSK4A and pGAT-T plasmids were digested by XhoI and hpaI, and the DNA bands of 4.1kb and 435bp were recovered respectively, and after ligation, they were transformed into E. coli DH5α, and positive clones were selected and name...

Embodiment 2

[0065] Example 2 Agrobacterium-mediated method to obtain bivalent transgenic tobacco

[0066] In this example, the transgenic tobacco with G2-aroA gene and gat gene was successfully obtained by using the Agrobacterium-mediated method.

[0067] The tobacco receptor material used is NC89, and the Agrobacterium is LBA4404. The specific operation steps are as follows:

[0068] 1) Preparation of competent Agrobacterium tumefaciens LBA4404

[0069] (1) Pick a single colony from the plate, inoculate it into 5ml YEB liquid medium (containing streptomycin Strep 125mg / L), and cultivate overnight at 28°C and 250rpm with shaking

[0070] (2) Take 2ml of bacterial liquid, add it to 50ml of YEB liquid medium (containing Strep125mg / L), shake and culture at 28°C and 250rpm until OD 600 About 0.6 or so

[0071] (3) Transfer the bacterial solution to a 50ml sterile centrifuge tube and place in an ice bath for 30min. Centrifuge at 5000rpm for 5min

[0072] (4) Discard the supernatant and us...

experiment example 1

[0086] Experimental Example 1 Molecular Detection of Transgenic Tobacco

[0087] 1.1 Extraction of tobacco DNA

[0088] 1) 25-50mg of fresh tobacco leaves are ground in a 1.5ml Eppendorf tube

[0089] 2) Add 700 μl 65°C preheated DNA extraction buffer (2% (W / V) CTAB, 1.42M NaCl, 20mM EDTA, 100mM Tris-HCl, 2% mercaptoethanol, pH8.0)

[0090] 3) Add 7μl RAase (20mg / ml), bathe in water at 65℃ for 1h

[0091] 4) Centrifuge at room temperature for 10 minutes

[0092] 5) Take the supernatant, add an equal volume of chloroform-isoamyl alcohol for extraction

[0093] 6) Centrifuge at room temperature for 10 minutes

[0094] 7) Take the supernatant, add 2 times the volume of absolute ethanol and 1 / 10 volume of 3M NaAc (pH5.2), and precipitate at -20°C for 30 minutes

[0095] 8) Centrifuge at 12000rpm, 4°C for 10min

[0096] 9) The precipitate was rinsed once with 70% ethanol, centrifuged and dried

[0097] 10) Add appropriate amount of TE to dissolve

[0098] 11) Measure the co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A bivalent plant expression carrier for culturing high anti-roundup transfer gene plant contains G2-aroA and gat. It has better anti-roundup performance and can be used to culture various high anti-roundup transfer gene plants.

Description

Technical field: [0001] The invention relates to a bivalent expression vector for cultivating glyphosate-resistant plants, in particular to a bivalent plant expression vector containing gat and G2-aroA genes. Background technique: [0002] Glyphosate is a systemic, broad-spectrum herbicide, and its mechanism of action is to inhibit the activity of EPSP synthase (full name: 5-enolpyruvylshikimate-3-phosphate synthase) in plants. Interferes with the biosynthesis of aromatic amino acids in plants, leading to plant death (S.R.Padgette et al., in Herbicide-Resistent Crops: Agricultural, Environmental, Economic, Regulatory, and Technical Aspects, S.O.Duke, Ed. (CRC Press, Boca Raton, FL, 1996), pp.53-84). [0003] If the EPSP synthase gene in the plant is mutated to produce an EPSP synthase with low affinity to glyphosate, which cannot bind glyphosate well or even at all, then the plant has glyphosate resistance ability. [0004] In addition, some people use acetyltransferase t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/52C12N15/54
Inventor林敏王旭静顿宝庆
OwnerLONGPING BIOTECHNOLOGY (HAINAN) CO LTD