Method for detecting vibrio parahaemolyticus PCR added with amplification internal sign
A technique for amplifying internal standard, Vibrio hemolyticus, applied in the determination/inspection of microorganisms, biochemical equipment and methods, resistance to vector-borne diseases, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0046] 1. Preliminary establishment of the detection system
[0047] 1. Select the target gene for detection
[0048] The known specific genes of Vibrio parahaemolyticus were analyzed by bioinformatics, and the target gene toxR was selected for detection. The sequence of the toxR gene was compared with other microorganisms through the public BLAST software in Genbank (an existing technology, which is free for sharing), and a sequence segment with higher specificity was selected. Then use the software Primer 5.0 (commercially available, Premier, Canada) to design a pair of internal standard primers in this specific sequence. The primer sequences are as follows:
[0049] t oxL: 5'- CAAATAGTAATTCGCTCGCAG -3'
[0050] t oxR: 5'- ATTCACAGCAGAAGCCACAG -3'
[0051] (a) Detect the sequence characteristics of the target gene:
[0052] * Length: 473 bp
[0053] *Type: nucleic acid
[0054] * Chain type: double chain
[0055] *Topology: linear
[0056] (b) Molecule type: DNA ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap