Method for detecting vibrio parahaemolyticus PCR added with amplification internal sign

A technique for amplifying internal standard, Vibrio hemolyticus, applied in the determination/inspection of microorganisms, biochemical equipment and methods, resistance to vector-borne diseases, etc.

Inactive Publication Date: 2008-01-23
SHANGHAI JIAO TONG UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no amplified internal standard has been tested for PCR of V. parahaemolyticus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting vibrio parahaemolyticus PCR added with amplification internal sign

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0046] 1. Preliminary establishment of the detection system

[0047] 1. Select the target gene for detection

[0048] The known specific genes of Vibrio parahaemolyticus were analyzed by bioinformatics, and the target gene toxR was selected for detection. The sequence of the toxR gene was compared with other microorganisms through the public BLAST software in Genbank (an existing technology, which is free for sharing), and a sequence segment with higher specificity was selected. Then use the software Primer 5.0 (commercially available, Premier, Canada) to design a pair of internal standard primers in this specific sequence. The primer sequences are as follows:

[0049] t oxL: 5'- CAAATAGTAATTCGCTCGCAG -3'

[0050] t oxR: 5'- ATTCACAGCAGAAGCCACAG -3'

[0051] (a) Detect the sequence characteristics of the target gene:

[0052] * Length: 473 bp

[0053] *Type: nucleic acid

[0054] * Chain type: double chain

[0055] *Topology: linear

[0056] (b) Molecule type: DNA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a PCR test method of a vibrio parahaemolyticus with internal amplification control in the food safety technology filed, which comprises steps as follows: firstly the construction and synthesis of the internal amplification control sequence artificially and design of the specific primers; secondly the PCR reaction system is laid in the best reaction condition; thirdly PRC is amplified; fourthly DNA of the different-serotype vibrio parahaemolyticus and different-species non vibrio parahaemolyticus is extracted for PRC test to identify the specific primers and confirm whether the internal amplification control can be normally amplified in the non vibrio parahaemolyticus sample test; finally the evaluation of the built PCR reaction through the artificial and natural pollution samples tests. The invention shows the occurrence of the false negative in the testing process and improves the accuracy rate. The invention provides efficient and reliable technical means to satisfy the urgent need of the foodborne patheogen investigation and test in the quarantine law enforcement.

Description

technical field [0001] The invention relates to a detection method in the technical field of food safety, in particular to a PCR detection method for Vibrio parahaemolyticus added with an amplified internal standard. Background technique [0002] PCR, the abbreviation of polymerase chain reaction in English, refers to: polymerase chain reaction. Vibrio parahaemolyticus (Vibrio parahaemolyticus) is a halophilic bacterium belonging to the genus Vibrio in the Vibrio family. It is Gram-negative and does not produce spores. In seawater, seabed sediments and marine organisms such as fish and shellfish. It is an important pathogen causing foodborne diseases. Poisoning will occur when people eat seafood such as crabs, oysters, shrimps, shellfish, etc. that are contaminated with the bacteria and have not been properly processed. Data from the National Foodborne Disease Surveillance Network shows that since 1998, in the monitored provinces and cities, the occurrence scale of Vibrio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04
CPCY02A50/30
Inventor 史贤明龙飞施春雷陈万义张忠明
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap