Primer and probe sequence for detecting dengue virus 3 nucleotides fragment

Abstract

The invention provides a PCR expansion primer and probe sequence for a dengue virus type III nucleotide section. The primer sequence comprises a primer pair comprising an upstream primer DenIIIpf of sequence GGAAAACCGTCTATCAATATGCTG and a downstream primer Den IIIpr of sequence TCCTCTTGAGAATCTCTTCGCC. The probe DenIIIpb is of sequence CGCGTGAGAAACCGTGTGTCAACTG.

Description

technical field [0001] The invention relates to a primer and a probe sequence for detecting dengue virus type III nucleotide fragments. Background technique [0002] Dengue virus (dengue virus, DEN) is a single-stranded positive-sense RNA virus of the Flavivirus genus. According to the antigenicity of the E protein, it is divided into four serotypes: type I, type II, type III and type IV. Dengue virus is transmitted by Aedes aegypti and Aedes albopictus, causing dengue fever (DF) and dengue hemorrhagi fever / dengue shock syndrome (DHF / DSS) ). There are 100,000,000 people infected with dengue virus in the tropics and subtropical regions of the world every year, among which the Southeast Asia bordering my country is the most prevalent (WHO.1998). In the 20th century, dengue fever has had many pandemics around the world, with millions of cases, and it has been endemic in Southeast Asia. In 1978, an epidemic occurred in Guangdong, my country, and dengue virus type IV was isola...

AI Technical Summary

Problems solved by technology

[0003] The laboratory diagnosis of dengue virus has established a complete set of mature technologies at home and abroad. The traditional methods mainly include hemagglutination inhibition test, complement fixation test, neutralization test, etc., and these methods have low sensitivity to varying degrees. , poor specificity, cumbersome operation, time-consuming and other deficiencies, especially difficult to accurately type

With the successful development of dengue virus monoclonal antibodies, the typing and identification methods based on dengue virus type-specific monoclonal antibodies, such as indirect immunofluorescence (IFA) and enzyme-linked immunosorbent assay (ELIA), are widely used in various countries around the world. Dengue virus detection laboratory, the problem of accurate typing of dengue virus has been solved, but all these technologies still inevitably have the problem of time-consuming experiments, because these methods are all based on virus isolation and culture, not Suitable for early diagnosis of dengue fever

[0004] With the development of molecular biology technology, ordinary PCR method has been widely used in clinical diagnosis, but this technology requires post-processing of PCR products, which can easily lead to contamination of PCR products and a certain degree of non-specific amplification.

Images