Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Dunaliella salina EPSP synthetase and preparation method and application thereof

A Dunaliella salina and enzyme synthesis technology, applied in biochemical equipment and methods, DNA preparation, enzymes, etc., can solve problems such as lethal effects of crops, and achieve the effect of promoting production and development

Inactive Publication Date: 2008-03-19
SICHUAN UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to glyphosate's mechanism of action, it can also be lethal to crops

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dunaliella salina EPSP synthetase and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] The preparation of embodiment 1 Dunaliella salina EPSP synthetase gene

[0018] 1. Collection of Dunaliella salina

[0019] Dunaliella salina was purchased from the algae bank of Wuhan Institute of Hydrobiology, Chinese Academy of Sciences.

[0020] 2. Poly A + RNA isolation (Poly A + RNA isolation)

[0021] Total RNA of Dunaliella salina was extracted with Trizol reagent (purchased from Gibco). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis. The mRNA of Dunaliella salina was extracted using the kit instruction manual provided by Olidotex mRNA Kits (purchased from Qiagen).

[0022] 3. Construction of Dunaliella salina cDNA library (Cloning ofFull-length cDNA)

[0023] use SMART TM cDNA Library Construction Kit (purchased from ClonTech) provides the kit instructions, using λTriplEX2 (purchased from ClonTech) as a vector to construct the cDNA library of Dunaliella salina.

[0024] 4. Full-length cloning of Dunaliella salina...

Embodiment 2

[0036] The construction of embodiment 2 Dunaliella salina EPSP synthetase recombinant plasmid II

[0037] According to the full-length coding sequence of the Dunaliella salina EPSP synthetase gene prepared in Example 1, and under the condition of ensuring the correct reading frame, design primers that can amplify the complete coding reading frame, forward direction: 5'TCTGCTACTTTGGCGGCTCACAG3' , Reverse 5'AAGGACCCCAGGACTCAGAAGTCC3', and restriction enzyme cutting sites EcoRI and Xho I were introduced on the forward and reverse primers respectively. After PCR amplification, the Dunaliella salina EPSP synthetase gene TA was cloned into the intermediate vector pMD18-T (purchased from TaKaRa). The intermediate vector pMD18-T inserted with the Dunaliella salina EPSP synthetase gene was digested with EcoR I and Xho I, and the Dunaliella salina EPSP synthetase gene fragment was recovered. The expression vector pGEX-4T-1 (purchased from Amersham) was digested with EcoR I and Xho I, a...

Embodiment 3

[0038] Example 3 Activity Identification of Dunaliella salina EPSP Synthetase Gene

[0039] The Dunaliella salina EPSP synthetase recombinant plasmid constructed in Example 2 was transformed into Escherichia coli JM109 for functional identification of the enzyme.

[0040] 1. Identification of in vivo activity

[0041]Select the Escherichia coli JM109 transformed into the Dunaliella salina EPSP synthetase gene, and select the Escherichia coli JM109 transformed into the pGEX-4T-1 empty vector and the wild type Escherichia coli JM109 as controls. The same amount of glyphosate was added, and the biological function of the transformed Dunaliella salina EPSP synthetase was determined by comparing the inhibition of the control bacteria and the positive bacteria. Experiments showed that the Escherichia coli transformed with Dunaliella salina EPSP synthetase gene had obvious resistance to glyphosate.

[0042] 2. Identification of in vitro activity

[0043] Through the GST fusion exp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a dunaliella salina EPSP synthetase gene, a recombinant plasmid, an EPSP synzyme, and the preparation method and the purpose thereof. The dunaliella salina EPSP synthetase gene is derived from a dunaliella salina, the prepared dunaliella salina EPSP synthetase gene is cloned to an express vector, to form the recombinant plasmid which is expressed to form the EPSP synthetase. The prepared recombinant plasmid I is transferred into agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105, to be used to convert a model plant (a wild type), thus a transgenic plant which can produce the stand up quality to glyphosate can be cultivated. The present invention provides novel enzyme in order to prevent the agronomic crop from endangering by the glyphosate, thereby being advantageous to promote the yield increase and the development of the agriculture.

Description

technical field [0001] The present invention relates to a gene of EPSP synthetase, recombinant plasmid, EPSP synthetase and its preparation method and application. Background technique [0002] Glyphosate (Glyphosate) is currently the most widely used broad-spectrum herbicide. It has low toxicity to humans and animals, it is difficult for weeds to develop resistance to it, and it has low soil residue. The market potential is huge. However, due to glyphosate's mechanism of action, it can also be lethal to crops. In order to meet the needs of large-scale mechanized production and glyphosate application, people have done a lot of work to cultivate glyphosate-resistant crops since the mid-1980s. Existing studies have shown that by stably transferring the 5-enolpyruvylshikimate-3-phosphate synthase (5-enolpyruvylshikimate3-phosphate synthase, EPSP synthase, EPSPS) gene into the genome of the plant, its gene translation product A considerable amount of accumulation in the chloro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/52C12N9/00C12N15/10C12N15/82C12N1/21
Inventor 曹毅乔代蓉白林含徐辉易弋
Owner SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com