Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Characteristic DNA sequence for dendrobium officinale test-tube plantlet and application thereof

A technology of DNA sequence and Dendrobium candidum, applied in the field of molecular biology, can solve the problems of difficult identification, inability to determine the type of source, and small plants, and achieve the effects of good specificity, great practical value, and high accuracy

Active Publication Date: 2008-08-06
上海上药神象健康药业有限公司
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the preciousness, rarity, and limited source of Dendrobium officinale, its confusion is not uncommon; in addition, because of the small size of the test-tube seedlings cultivated through asexual reproduction, it is impossible to judge the type of source from the appearance; In the process of reproduction and cultivation, due to the change of the ecological environment and the influence of people's production activities, whether there will be variation, etc., it is very difficult to identify these phenomena by relying on traditional methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Characteristic DNA sequence for dendrobium officinale test-tube plantlet and application thereof
  • Characteristic DNA sequence for dendrobium officinale test-tube plantlet and application thereof
  • Characteristic DNA sequence for dendrobium officinale test-tube plantlet and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] The acquisition of the characteristic DNA sequence of embodiment 1 Dendrobium officinale tube plantlet

[0055] 1 Materials and methods

[0056] 1.1 Materials

[0057] The names and sources of the experimental materials are shown in Table 1. The wild Dendrobium officinale were collected from Yunnan, Guangxi and other production areas, and the test-tube seedlings of Dendrobium officinale were provided by the Shanghai Institute of Traditional Chinese Medicine.

[0058] Table 1. Material names and sources

[0059] Numbering

material name

Numbering

material name

Numbering

material name

[0060] 1

D. devonianum Dendrobium I

12

D.sp good bamboo stick

23

D. trigonopus dendrobium

2

D. devonianum Dendrobium II

13

D. aphyllum dendrobium

24

D. fimbriatum Verbena officinale

3

D. strongylanthum comb-lipped Dendrobium

14

D. chrysanthum bouquet Dendrobium...

Embodiment 2

[0100] The acquisition and identification of the specific probe of embodiment 2 Dendrobium officinale test-tube plantlets

[0101] 1 method

[0102] 1.1 The design of the specific probe of Dendrobium officinale tube plantlet

[0103] For the Dendrobium candidum test-tube plantlet characteristic DNA sequence that embodiment 1 obtains, use Primer Premier 5.0 (PREMIERBiosoft International development) software design to carry out primer sequence design, have designed four pairs of primers, synthesize:

[0104] (1) AS1 group: S1 5'AGGAAGATGAACTTGCCGATAC 3' (SEQ ID NO: 8)

[0105] A1 5' TCGGTCGTCCCGTCGTAT 3' (SEQ ID NO: 9)

[0106] (2) AS2 group: S2 5'AAGTGCCAAATGTTGAGTC 3' (SEQ ID NO: 10)

[0107] A2 5'CCTGGAATCTGTCGTGCT 3' (SEQ ID NO: 11)

[0108] (3) AS3 group: S3 5'CGAGACACCGTCCATTCA 3' (SEQ ID NO: 12)

[0109] A3 5'TTCCGACATTGGGCTTTA 3' (SEQ ID NO: 13)

[0110] (4) AS4 group: S4 5'AGGAAGATGAACTTGCCGATAC 3' (SEQ ID NO: 14)

[0111] ...

Embodiment 3

[0117] The genetic analysis of embodiment 3 different algebra Dendrobium officinale test-tube plantlets

[0118] By establishing a special test-tube plantlet culture line of Dendrobium candidum, the genetic status of plants of different generations in the same line was compared longitudinally.

[0119] Take different generations 1, 2, 4, 6, 8, 10, An (Dendrobium candidum test-tube seedling samples with passage number more than 10 generations) and wild Dendrobium candidum tissue culture test-tube plantlets and wild Dendrobium, carry out DNA extraction, use specificity The probes were amplified by PCR, and the results were as follows Figure 4 shown. The results of amplification with the specific probe of Dendrobium officinale test tube plantlets showed that there was no change in each generation, and the same bands were all expanded.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a character DNA sequence of dendrobium officinale tube seedling and the application. The invention discloses a character DNA sequence of dendrobium officinale tube seedling, which is the DNA sequence of SEQ ID NO: 1or the complementary sequence. The invention also discloses a usage for utilizing specificity probe of dendrobium officinale tube seedling in identifying dendrobium officinale tube seedling and an identifying method. The character DNA sequence of dendrobium officinale tube seedling which is used to identify dendrobium officinale tube seedling and dendrobium officinale has high accuracy and excellent specificity, the identification technique is easy to master.

Description

technical field [0001] The present invention relates to the field of molecular biology, and further the present invention relates to the characteristic DNA sequence of the dendrobium officinale test-tube plantlet and its application. Background technique [0002] Dendrobium officinale Kimura et Migo, belonging to Orchidaceae (Orchidaceae) Dendrobium Sw., is a perennial epiphytic herb. Stomach, heat-clearing and nourishing yin and other effects. Modern pharmacological studies have shown that Dendrobium officinale has anti-tumor, anti-aging, enhanced immunity, dilating blood vessels and anti-platelet aggregation effects. [0003] Dendrobium officinale has a special growth environment, coupled with long-term excavation, has become a rare and endangered medicinal plant. In order to save this precious drug source, the sustainable development and utilization of Dendrobium officinale resources have been realized through the success of vegetative propagation of test-tube plantlets...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12Q1/68
Inventor 顾慧芬梅其春庄意丽
Owner 上海上药神象健康药业有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More