Unlock instant, AI-driven research and patent intelligence for your innovation.

Peptides and related compounds having thrombopoietic activity

A compound and composition technology, applied in the field of peptides and related compounds, can solve problems such as lack of sequence homology

Inactive Publication Date: 2008-08-13
AMGEN INC
View PDF33 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This 14-residue TPO mimetic peptide has no significant sequence homology to TPO or MGDF

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Peptides and related compounds having thrombopoietic activity
  • Peptides and related compounds having thrombopoietic activity
  • Peptides and related compounds having thrombopoietic activity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0261] Construction of secondary peptide libraries

[0262] A. Preparation of electrocompetent E. coli cells:

[0263] Overnight E. coli cultures (TG1 strain; Amersham Pharmaceutical Biotech, Piscataway, NJ) were prepared in 10 ml of 2xYT medium (1.6% Bacto tryptone, 1% yeast extract, 85.5 mM NaCl) at 37°C. 1 µl of this overnight culture was used to inoculate 1 L containing 0.4% glucose and 1 mM MgCl 2 2xYT medium, grow this liter culture in a shaker at 37 °C until the OD 600 = 0.8. The culture was frozen on ice for 15 minutes and centrifuged (Beckman JA-10 centrifuge) at 4000 rpm for 20 minutes at 4°C. The bacterial pellet was resuspended in 500 ml of ice-cold 10% glycerol solution and the resulting mixture was centrifuged at 4000 rpm for 20 minutes at 4°C. The bacterial pellet was resuspended in 500 ml of ice-chilled 10% glycerol solution and the resulting mixture was centrifuged again at 4000 rpm for 20 minutes at 4°C. The bacterial pellet was resuspended in 500 ml of ...

Embodiment 2

[0315] Peptide Preparation

[0316] All peptides were prepared by established stepwise solid phase synthesis methods. Merrifield (1963), J. Am. Chem. Soc. 85:2149. Steward and Young (1969), Solid phase peptide synthesis. Fmoc-protected amino acids are used as building blocks to construct peptide chains using ABI or Symphony peptide synthesizers. Typically, peptide synthesis is initiated with preloaded Wang resin, yielding peptides with a free carboxylic acid at the C-terminus (alternatively, Rink resin can be utilized to produce peptides with C-terminal amide functionality). Removal of Fmoc was performed in a standard piperidine protocol. Coupling is performed using uronium (eg HBTU) or carbodiimide (eg DCC / HOBt) chemistry. Side chain protection groups are: Glu(O-t-Bu), Asp(O-t-Bu), Ser(t-Bu), Thr(t-Bu), Arg(Pbf), Asn(Trt), Gln(Trt), His(Trt), Lys(t-Boc), Trp(t-Boc), and Cys(Trt). 4 hours at RT, using 2.5% HO 2 O, 5% phenol, 2.5% triisopropylsiloxane and 2.5% thioanisol...

Embodiment 3

[0318] Preparation of TMP-Fc peptibody compound

[0319] Several peptides were selected for expression as peptide-Fc fusions (ie, Fc attached to the C-terminus of the peptide) (C-terminal fusions). The DNA sequence encoding the Fc region of human IgG1 fused in frame to the respective TPO mimetic peptide was placed under the control of the luxPR promoter in the plasmid expression vector pAMG21 as follows.

[0320] The plasmid encoding TMP1-Fc (Amgen strain #3788) was altered to contain an ApaLI site and an XhoI site, allowing easy cloning of short peptides from the annealed oligonucleotides. Primer 2396-69 was used to add ApaLI and XhoI restriction enzyme sites. PCR was performed using the extended-long polymerase of 2396-69 and the universal 3' primer 191-24 on the 3788 DNA template. The primer sequences are as follows:

[0321] 2396-69 ACAAACAAACATATGGGTGCACAGAAAGCGGCCGCAAAAAAACTCGAGGGTGGAGGCGGTGGGGACA

[0322] 191-24 GGTCATTACTGGACCGGATC

[0323] The resulting PCR fragm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
affinityaaaaaaaaaa
Login to View More

Abstract

The invention relates to peptides including thrombopoietic activity and relative compounds. More particularly, the invention relates to the compounds combining with mpl acceptor and physiologically acceptable salts thereof, the compounds comprises the following sequence: X1-X2-X3-X4-G-P-T-L-X9-X10-W-L-X13-X14-X15-X16-X17-X18. The invention also relates to a composite comprising the compounds, nucleotide which codes the composite and a carrier and a cell comprising the nucleotide. The compounds of the invention can be used for improving the yield of thrombocyte or thrombocyte precursor (e.g. megakaryocyte) in a mammal.

Description

[0001] This application is a divisional application of the invention patent application with the filing date of October 11, 2002, the application number of 02824735.3, and the invention title of "peptides with platelet-forming activity and related compounds". field of invention [0002] The present invention relates generally to peptides and related compounds having thrombopoietic activity. The compounds of the invention are useful for increasing the production of platelets or platelet precursors (eg, megakaryocytes) in mammals. Background technique [0003] The present invention relates to compounds, especially peptides, which have the ability to stimulate the in vivo and in vitro production of platelets and their precursor cells, such as megakaryocytes. Two proteins known to have thrombopoietic activity are provided as background below: thrombopoietin (TPO) and megakaryocyte growth and development factor (MGDF). [0004] Cloning of endogenous thrombopoietin (TPO) (Lok et ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K7/08C07K14/52A61K38/12A61P7/00A61P43/00
Inventor H·棉K·C·西特尼C·哈特利
Owner AMGEN INC