Peptides and related compounds having thrombopoietic activity
A compound and composition technology, applied in the field of peptides and related compounds, can solve problems such as lack of sequence homology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0261] Construction of secondary peptide libraries
[0262] A. Preparation of electrocompetent E. coli cells:
[0263] Overnight E. coli cultures (TG1 strain; Amersham Pharmaceutical Biotech, Piscataway, NJ) were prepared in 10 ml of 2xYT medium (1.6% Bacto tryptone, 1% yeast extract, 85.5 mM NaCl) at 37°C. 1 µl of this overnight culture was used to inoculate 1 L containing 0.4% glucose and 1 mM MgCl 2 2xYT medium, grow this liter culture in a shaker at 37 °C until the OD 600 = 0.8. The culture was frozen on ice for 15 minutes and centrifuged (Beckman JA-10 centrifuge) at 4000 rpm for 20 minutes at 4°C. The bacterial pellet was resuspended in 500 ml of ice-cold 10% glycerol solution and the resulting mixture was centrifuged at 4000 rpm for 20 minutes at 4°C. The bacterial pellet was resuspended in 500 ml of ice-chilled 10% glycerol solution and the resulting mixture was centrifuged again at 4000 rpm for 20 minutes at 4°C. The bacterial pellet was resuspended in 500 ml of ...
Embodiment 2
[0315] Peptide Preparation
[0316] All peptides were prepared by established stepwise solid phase synthesis methods. Merrifield (1963), J. Am. Chem. Soc. 85:2149. Steward and Young (1969), Solid phase peptide synthesis. Fmoc-protected amino acids are used as building blocks to construct peptide chains using ABI or Symphony peptide synthesizers. Typically, peptide synthesis is initiated with preloaded Wang resin, yielding peptides with a free carboxylic acid at the C-terminus (alternatively, Rink resin can be utilized to produce peptides with C-terminal amide functionality). Removal of Fmoc was performed in a standard piperidine protocol. Coupling is performed using uronium (eg HBTU) or carbodiimide (eg DCC / HOBt) chemistry. Side chain protection groups are: Glu(O-t-Bu), Asp(O-t-Bu), Ser(t-Bu), Thr(t-Bu), Arg(Pbf), Asn(Trt), Gln(Trt), His(Trt), Lys(t-Boc), Trp(t-Boc), and Cys(Trt). 4 hours at RT, using 2.5% HO 2 O, 5% phenol, 2.5% triisopropylsiloxane and 2.5% thioanisol...
Embodiment 3
[0318] Preparation of TMP-Fc peptibody compound
[0319] Several peptides were selected for expression as peptide-Fc fusions (ie, Fc attached to the C-terminus of the peptide) (C-terminal fusions). The DNA sequence encoding the Fc region of human IgG1 fused in frame to the respective TPO mimetic peptide was placed under the control of the luxPR promoter in the plasmid expression vector pAMG21 as follows.
[0320] The plasmid encoding TMP1-Fc (Amgen strain #3788) was altered to contain an ApaLI site and an XhoI site, allowing easy cloning of short peptides from the annealed oligonucleotides. Primer 2396-69 was used to add ApaLI and XhoI restriction enzyme sites. PCR was performed using the extended-long polymerase of 2396-69 and the universal 3' primer 191-24 on the 3788 DNA template. The primer sequences are as follows:
[0321] 2396-69 ACAAACAAACATATGGGTGCACAGAAAGCGGCCGCAAAAAAACTCGAGGGTGGAGGCGGTGGGGACA
[0322] 191-24 GGTCATTACTGGACCGGATC
[0323] The resulting PCR fragm...
PUM
| Property | Measurement | Unit |
|---|---|---|
| affinity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 