Primer and probe sequence for detecting dengue virus II type nucleic acid fragment
A dengue virus, primer sequence technology, applied in biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve the problems of PCR product contamination, low sensitivity, cumbersome operation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0011] 1. Design of primers and probes: Through comparative analysis of all known dengue virus type II genome sequences, select a segment with no secondary structure and a high degree of conservation, and design multiple pairs of primers and probes. The length of the primers is generally About 20 bases, there is no complementary sequence between the primers and within the primers. The optimal primer and probe sequence combinations are as follows:
[0012] Upstream primer Den II pf: TTCATGGCCCTGGTGGC
[0013] Downstream primer Den II pr: TGATTTTTTRATTGTTCCCCATCT
[0014] Probe Den II pb: CGTTTCCTAACAATCCCACCAACAGC
[0015] 2. Establishment and optimization of the reaction system: use the inactivated dengue virus type II as the sample to be tested, use the extraction method of Trizol nucleic acid extraction reagent to extract the viral genome RNA, and store it at -20°C for later use.
[0016] 2.1 Optimization of primer concentration In the case of the same other conditions in...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap