Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer and probe sequence for detecting dengue virus II type nucleic acid fragment

A dengue virus, primer sequence technology, applied in biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve the problems of PCR product contamination, low sensitivity, cumbersome operation, etc.

Inactive Publication Date: 2008-08-13
TAITAI GENOMICS +1
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The laboratory diagnosis of dengue virus has established a complete set of mature technologies at home and abroad. The traditional methods mainly include hemagglutination inhibition test, complement fixation test, neutralization test, etc., and these methods have low sensitivity to varying degrees. , poor specificity, cumbersome operation, time-consuming and other deficiencies, especially difficult to accurately type
With the successful development of dengue virus monoclonal antibodies, the typing and identification methods based on dengue virus type-specific monoclonal antibodies, such as indirect immunofluorescence (IFA) and enzyme-linked immunosorbent assay (ELIA), are widely used in various countries around the world. Dengue virus detection laboratory, the problem of accurate typing of dengue virus has been solved, but all these technologies still inevitably have the problem of time-consuming experiments, because these methods are all based on virus isolation and culture, not Suitable for early diagnosis of dengue fever
[0004] With the development of molecular biology technology, ordinary PCR method has been widely used in clinical diagnosis, but this technology requires post-processing of PCR products, which can easily lead to contamination of PCR products and a certain degree of non-specific amplification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe sequence for detecting dengue virus II type nucleic acid fragment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] 1. Design of primers and probes: Through comparative analysis of all known dengue virus type II genome sequences, select a segment with no secondary structure and a high degree of conservation, and design multiple pairs of primers and probes. The length of the primers is generally About 20 bases, there is no complementary sequence between the primers and within the primers. The optimal primer and probe sequence combinations are as follows:

[0012] Upstream primer Den II pf: TTCATGGCCCTGGTGGC

[0013] Downstream primer Den II pr: TGATTTTTTRATTGTTCCCCATCT

[0014] Probe Den II pb: CGTTTCCTAACAATCCCACCAACAGC

[0015] 2. Establishment and optimization of the reaction system: use the inactivated dengue virus type II as the sample to be tested, use the extraction method of Trizol nucleic acid extraction reagent to extract the viral genome RNA, and store it at -20°C for later use.

[0016] 2.1 Optimization of primer concentration In the case of the same other conditions in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention is a PCR amplifying primer and probe sequence for dengue virus II nucleotide fragment. The primer sequence includes a primer pair composed of upstream primer Den II pf having sequence TTCATGGCCCTGGTGGC and downstream primer Den II pr having sequence TGATTTTTTRATTGTTCCCCATCT. The probe Den II pb sequence is CGTTTCCTAACAATCCCACCAACAGC.

Description

technical field [0001] The invention relates to a primer and a probe sequence for detecting dengue virus type II nucleotide fragments. Background technique [0002] Dengue virus (dengue virus, DEN) is a single-stranded positive-sense RNA virus of the Flavivirus genus. According to the antigenicity of the E protein, it is divided into four serotypes: type I, type II, type III and type IV. Dengue virus is transmitted by Aedes aegypti and Aedes albopictus, causing dengue fever (DF) and dengue hemorrhagi fever / dengue shock syndrome (DHF / DSS) ). There are 100,000,000 people infected with dengue virus in the tropics and subtropical regions of the world every year, among which the Southeast Asia bordering my country is the most prevalent (WHO.1998). In the 20th century, dengue fever has had many pandemics around the world, with millions of cases, and it has been endemic in Southeast Asia. In 1978, an epidemic occurred in Guangdong, my country, and dengue virus type IV was isolat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCY02A50/30
Inventor 吴新伟张经纬肖性龙王鸣狄飚
Owner TAITAI GENOMICS