Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing transgenic cultivated silkworm with high resistance for blood type nuclear polyhedrosis

A technology for blood-type pus and its production method, which is applied in the field of producing transgenic silkworms with high resistance to blood-type pus, can solve the problems of low cutting efficiency of long-segment dsRNA and affect BmNPV resistance, and achieve compensation for cutting efficiency Not high, easy to filter, prevent loss effect

Inactive Publication Date: 2008-09-24
SUZHOU UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The common point of the prior art described in the above-mentioned documents is that the genes necessary for the propagation of the polyhedrosis virus are selected from the long fragments of the ie-1 and lef-1 genes of BmNPV or the long fragments of genes necessary for the propagation of other polyhedrosis viruses The combination of transgenic and RNAi technology improves the silkworm's resistance to BmNPV, but insect cells are not efficient at cutting long fragments of dsRNA, thus affecting the resistance of the obtained transgenic silkworm and its offspring to BmNPV, so the following problems still need to be solved :

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Construction of silkworm transgenic vector pigRNAi neo -ie-lef

[0030] The technical operation process is as follows:

[0031] 1. Construct PU6-AntiIE carrier

[0032] Including the following steps:

[0033] (1) With the 1623nt of the coding region of the baculovirus ie-1 gene (the accession number on GenBank is L33180) as the design start site of the RNAi target sequence, the length of the target sequence is 21nt, and the following sequence is synthesized:

[0034] TAGGATCCGATATC TCAAGAG TTATTGTGCAATGTAGTGCTC tttttGGTACCGA, where the shaded part is the target sequence, and the underlined part is the inverted repeat sequence of the target sequence;

[0035] The sequence was double digested with BamH I and Kpn I, and then cloned into the pRNAT-U6.1 / Neo (GenScript Company) vector to obtain the pRNAi-ie plasmid.

[0036] (2) Using the silkworm genome as a template, with

[0037] L-polyA1 (caggtaccgtgtttgcgttaggattttttttggaag) and

[0038] L-polyA2 (gta...

Embodiment 2

[0060] Example 2: Using pigRNAi neo -ie-lef vector to produce transgenic silkworm resistant to blood type pus

[0061] The silkworm variety is Jingsong variety, and it was raised normally until moths turned into moths.

[0062] (1) PigRNAi neo -ie-lef and helper plasmid pHA3PIG (Tamura Toshiki. et al. Germline transformation of the silkworm Bombyx moriL. using a piggyBactransposon-derived vector. Nature Biotechnology, 2000, 18: 81-84) were mixed 1:1 (mixing concentration 2μg / μL), introduced into the newly laid eggs, and the hatched silkworms were continuously fed with 10000 μg / mL of G418 until the 4th instar, and the silkworms resistant to G418 and with fluorescent protein reporter genes were obtained.

[0063] (2) PCR detection of transgenic silkworm

[0064] Acupuncture a small amount of fluorescent silkworm hemolymph (about 20 μL hemolymph / head), add 500 μL TE buffer (pH8.0), add 500 μL supersaturated phenol (pH8.0) for 10 minutes, centrifuge at 12000 rpm for 10 minutes...

Embodiment 3

[0068] Example 3: Construction of silkworm transgenic vector pigRNAi neo -ie-lef-A

[0069] The technical operation process is as follows:

[0070] 1. Construct PU6-AntiIE-A vector

[0071] Including the following steps:

[0072] (1) With the 887th nt of the coding region of the baculovirus ie-1 gene (the accession number on GenBank being L33180) as the design start site of the RNAi target sequence, the target sequence length is 21nt, and the following sequence is synthesized:

[0073] TAGGATCCGATATC TCAAGAG TTTGTGCAGCCGTCTCGTCGT tttttGGTACCGA (the shaded part is the target sequence, and the underlined part is the inverted repeat of the target sequence).

[0074] After the sequence was double digested with BamH I and Kpn I, it was cloned into the pRNAT-U6.1 / Neo (GenScript company) vector to obtain the pRNAi-ie-A plasmid;

[0075] (2) Using the silkworm genome as a template, with

[0076] L-polyA1 (caggtaccgtgtttgcgttaggattttttttggaag) and

[0077] L-polyA2 (gtaagcttc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing transgene silkworms for improving resistance to nuclear polyhedrosis. A transgene vector which carries dsRNA expression cassette of ie-1 genes of bombyx mori nuclear polyhedrosis viruses, dsRNA expression cassette of lef-1 genes, is provided with neomycin resistance genes Neo and fluorescent protein reporter genes, and based on a piggyBAC transposon, is established through gene engineering operations. The transgene vector is introduced into primarily laid eggs, and the resistance of the transgene silkworms to nuclear polyhedrosis is significantly improved. By combing transgenes with RNAi technology, the resistance of silkworms to nuclear polyhedrosis is improved, and the screening process of transgene silkworms is optimized.

Description

technical field [0001] The invention relates to the field of transgenic breeding, in particular to a method for producing transgenic silkworms with high resistance to blood type pus. Background technique [0002] Bombyx mori blood-type pustosis is an infectious silkworm disease that often occurs in sericulture production, and is one of the important reasons for cocoon yield failure. The disease is caused by Bombyx mori Nucleopolyhedrovirus (BmNPV) infection. In the last century, in the production of silkworms, people comprehensively applied the research results of genetics, physiology, pathology, ecology, etc., through thorough disinfection, eliminated the source of infection, strengthened feeding management, improved the resistance of silkworms to viruses and Measures such as raising disease-resistant varieties have achieved obvious results in the comprehensive prevention and treatment of silkworm blood type pus disease. However, taking these measures in large-scale sericu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/11A01K67/04C12N15/113
Inventor 贡成良薛仁宇曹广力沈卫德
Owner SUZHOU UNIV