Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SiRNA inhibiting toxoplasma gondii wx2 gene expression and use thereof

A technology of gene expression and Toxoplasma gondii, applied in the field of siRNA, can solve the problems of rapid reinfection of Toxoplasma gondii, long treatment cycle, and inability to cure, and achieve the effect of delaying the onset and death time of animals, and prolonging the survival time

Inactive Publication Date: 2008-11-05
CENT SOUTH UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there is no very ideal drug for the treatment of toxoplasmosis. The existing chemical drugs have defects such as long treatment cycle, large drug side effects, and inability to cure them. So far, there is no drug that can kill the parasites in the cyst. In addition, the superinfection of Toxoplasma gondii is very rapid, so it has not been well contained despite various efforts

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SiRNA inhibiting toxoplasma gondii wx2 gene expression and use thereof
  • SiRNA inhibiting toxoplasma gondii wx2 gene expression and use thereof
  • SiRNA inhibiting toxoplasma gondii wx2 gene expression and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] 1. Design and synthesis of siRNA

[0040] psUPER-retro plasmid ( figure 1 ) was a gift from Dr. Luo Shuhong, University of Illinois, USA.

[0041] According to the design principles of wx2 and wx gene cDNA sequences and siRNA and the characteristics of the vector pSUPER.retro, three pairs of nucleotide target sequences containing N-19 with hairpin structure were designed respectively, and the sequences were synthesized by Shanghai Sangong.

[0042] 1. wx2a. (Enzyme cutting site is Bgl II, HindIII)

[0043] 5'- GATCCC CACACATTCCTCACAGACGCTTCAAGAGAGCGTCTGTGAGGAATGTGTTTTTTA-3' (SEQ ID NO. 3)

[0044] 5'- AGCTTA AAAAACACATTCCTCACAGACGCTCTCTTGAAGCGTCTGTGAGGAATGTGTGGG-3' (SEQ ID NO. 4)

[0045] 2. wx2b. (Enzyme cutting site is Bgl II, HindIII)

[0046] 5'- GATCCC CCATCCGTAAAGCGGTGAGTTTCAAGAGAACTCACCGCTTTACGGATGTTTTTA-3' (SEQ ID NO. 5)

[0047] 5'- AGCTTA AAAACATCCGTAAAGCGGTGAGTTCTCTTGAAACTCACCGCTTTACGGATGGGG-3' (SEQ ID NO. 6)

[0048] 3. Wx2c. (Enzyme cutting si...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention particularly relates to a siRNA for restaining the TOX wx 2 gene expression and an application of the siRNA to the screening of the TOX attenuated virus or toxicity-decreasing living vaccine. A pair of 60 ribonucleotide barrette-shaped DNA respectively containing 9 basic group palindrome structures is designed according to the 895 to 913 position sequence of the TOX wx 2 gene (the accession number of GenBank is AY238892). The barrette-shaped DNA is adopted to produce interfering particles which are guided into the TOX body by the electroporation method to obtain the RNA interfering TOX strain wx 2b-I capable of expressing the siRNA continuously in the TOX body, the animal infection experiment shows that the toxicity of the TOX is reduced evidently; the surviving time of a mouse with the toxicity is evidently longer than the negative control and wild type TOX strain; the attenuated virus or toxicity-decreasing living vaccine used for the cattle and pets are hopeful to be explored.

Description

technical field [0001] The invention relates to an siRNA, in particular to an siRNA inhibiting the expression of the toxoplasma wx2 gene and its application in screening live attenuated vaccines of the toxoplasma gondii. Background technique [0002] Toxoplasma gondii is an obligate intracellular parasitic opportunistic protozoa with a complex life cycle and many tissues and organs involved. Toxoplasma gondii infection in pregnant women can cause miscarriage, premature birth, teratogenicity, stillbirth, congenital toxoplasmosis in infants and young children, mental retardation in children, etc., which has a serious impact on population quality and prenatal care. In recent years, with the rise of pet fever, the opportunities for human-animal contact have increased, which has brought new problems to the prevalence of toxoplasmosis. Toxoplasma encephalitis has become one of the leading causes of death in AIDS patients, as well as one of the leading causes of death and psychiat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/867C12Q1/68C12N15/113
Inventor 吴翔舒衡平谭奎张琼
Owner CENT SOUTH UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More