Comamonas testosterone engineering bacteria and use thereof
A technology of Comamonas and testosterone, applied in application, genetic engineering, bacteria, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment one, the construction method of engineering bacterium AMCa3 (CGMCC No.2364), comprises the following steps:
[0043] 1. Cloning of C.test activator gene
[0044] The total DNA of the bacteria was extracted from the overnight cultured C.test according to the method in the "Guidelines for Molecular Biology Experiments" and used as a template for PCR amplification. Using the chromosomal DNA of C.test as a template, primers were designed according to the sequence of the activator gene (kpn I and Sma I restriction sites and protective bases were added to the primers at both ends), and the primers were synthesized by Shanghai Bioengineering Co., Ltd. The activator gene was amplified by PCR with Ex Taq enzyme from Dalian TaKaRa Company.
[0045] Primer1(+) (forward primer): 5'TTT GTGCGCGCAGTGCACTTCCAC3'30bp;
[0046] Primer2(-) (reverse primer): 5'TTT TCAATGCTGCAGCCGGGCCGT3'30bp
[0047] PCR products were subjected to 1.0% agarose electrophoresis, such as f...
Embodiment 2
[0079] Embodiment two, the preparation of engineering bacterium AMCa3 (CGMCC No.2364) bacterium suspension and be applied to the method for degrading steroid compound, comprise the following steps:
[0080] 1. Activation culture of engineering bacteria AMCa3 (CGMCC No.2364) and preparation of bacterial suspension
[0081] Take 200 μL of AMCa3 (CGMCC No.2364) glycerol cells stored at -70°C, inoculate them in 3 mL of LB medium, add 60 μg / mL of ampicillin and 30 μg / mL of kanamycin for shaking overnight culture , the rotation speed is 180r / min, and the culture temperature is 30°C. The overnight culture was inoculated in fresh LB medium containing corresponding antibiotics at a ratio of 1:100, and cultured with shaking until OD 600 =1.0, 10,000r / min centrifugal 5min, collect thalline, be suspended in the M8 inorganic salt medium that does not add any steroid compound, or M9 inorganic salt medium, or LB medium, just make AMCa3 (CGMCC No.2364 ) bacterial suspension. Said steroid c...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
