Unlock instant, AI-driven research and patent intelligence for your innovation.

Late promoter targeting regulation oncolytic adenovirus pCN305 vector and construction method and application thereof

An oncolytic adenovirus and late promoter technology, which is applied in the field of construction of dual-targeted oncolytic adenovirus vectors, can solve the problems of hindering the clinical efficacy of tumor gene therapy, unable to completely kill tumor cells, and unable to treat the high-efficiency expression of genes. , to achieve good tumor killing effect, enhance killing ability, and enhance the effect of safety

Inactive Publication Date: 2009-03-11
ZHEJIANG SCI-TECH UNIV
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, most of the vector systems still cannot make the therapeutic gene be highly expressed specifically in tumor cells, so they cannot completely kill tumor cells, which seriously hinders the clinical efficacy of tumor gene therapy.
In a tumor patient, if only part of the tumor cells can be killed, the remaining few cells will grow quickly, leading to tumor recurrence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Late promoter targeting regulation oncolytic adenovirus pCN305 vector and construction method and application thereof
  • Late promoter targeting regulation oncolytic adenovirus pCN305 vector and construction method and application thereof
  • Late promoter targeting regulation oncolytic adenovirus pCN305 vector and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Construction of tumor-targeted adenoviral vector PCN305 carrying exogenous genes and obtaining viruses such as AdCN305-IL-24, AdCN305-SOCS3 and AdCN305-cpp-SOCS3. A. Construction of transfer plasmid pCZ305:

[0079] First design the following primers:

[0080] Ad66:5'CCAGAATATTGGAACTTTAG 3'

[0081] BYZGR

[0082] Ad67:5'GGATCCATCGAGGATCCTCATTCTTGGGCAATGTATGAA 3'

[0083] BamHI

[0084] Ad68: 5'GGATCCGTCGACTCGCGAGAATCGTTTGTGTTATGTT 3'

[0085] BamHI

[0086] Ad69:5'CTTAAGTGAGCTGCCCGGGGA 3'

[0087] AflII

[0088] ① Construct transfer vector pCZ301:

[0089] Plasmid pTG1801 was digested with HindIII, and the 2937bp fragment was recovered by electrophoresis after complete digestion. This fragment was ligated and transformed with the vector pGEM-11Zf(+) which was also digested with HindI II and dephosphorylated, and the correct positive clone was taken and named pCZ301.

[0090] ② Construction of transfer vector pCZ302:

[0091]Using ...

Embodiment 2

[0108] Example 2: Expression ability in SOCS3 cells after virus infection.

[0109] The virus AdCN305-SOCS3 was used to infect five kinds of cells including MRC5, BEL7404, Hep3B, H460 and Bcap37 at 5 MOI respectively. After 48 hours, the total protein of the cells was extracted, and the expression of SOCS3 protein was analyzed by Western-blot. Such as Figure 4 As shown, from left to right, AdCN305-SOCS3 expresses SOCS3 in human embryonic lung cell MRC5, human liver cancer cell line BEL7404, human liver cancer cell line Hep3B, human lung cancer cell line H460, and human breast cancer cell line Bcap37. Level. In normal cell MRC5, the expression level of SOCS3 protein was low, indicating a low virus replication rate. In the four tumor cells, the expression level of SOCS3 protein was higher, indicating a higher rate of virus replication.

Embodiment 3

[0110] Example 3: SOCS3 induces tumor cell apoptosis.

[0111] Viruses Ad-wt, AdCN305-SOCS3 and AdCN305-cpp-SOCS3 were used to infect human lung cancer cells H460 at 5 MOI. After 48 hours of treatment, the ability of SOCS3 to induce tumor cell apoptosis was detected by Hochest staining. Such as Figure 5 Shown, where, a represents the Hochest staining of PBS blank control group, b represents the Hochest staining after Ad-wt acts on H460 cells, c represents the Hochest staining after AdCN305-SOCS3 acts on H460 cells, d represents AdCN305-cpp-SOCS3 acts on H460 cells Cells were stained by Hochest. It can be seen that the viruses AdCN305-SOCS3 and AdCN305-cpp-SOCS3 can induce tumor cell apoptosis, but PBS and Ad-wt did not induce tumor cell apoptosis. (Arrows point to apoptotic cells)

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a late promoter targeting adjustment and control oncolytic adenovirus pCN305 vector, a construction method and application thereof. The vector is established on a pCN103 vector with targeting property; all exogenous genes for killing and inhibiting various cancers, such as IL-24, TRAIL, SOCS3, cpp-SOCS3, SOCS1, cpp-SOCS1and so on, are adjusted, controlled and expressed by late promoters of viruses through induction of internal ribosome into IRES sites and polyclonal sites; and the pCN305 vector has good anticancer effect through experiment in vivo and vitro. All double-target replicating oncolytic adenovirus established by application of the pCN305 vector, such as AdCN305-IL-24, AdCN305-TRAIL, AdCN305-SOCS3, AdCN305-cpp-SOCS3, AdCN305-SOCS1, AdCN305-cpp-SOCS1 and so on, can be used for treating various tumors. Moreover, the invention can develop a novel virus-gene anticancer medicine for effectively treating the tumors.

Description

technical field [0001] The invention belongs to the field of gene therapy, in particular to a method for constructing a dual-target (tumor-targeted) oncolytic adenoviral vector capable of expressing foreign genes efficiently using its own late promoter and carrying all the foreign genes capable of killing and inhibiting cancer. Application of genes such as IL-24, TRAIL, SOCS3, cpp-SOCS3, SOCS1 and cpp-SOCS1. Background technique [0002] Malignant tumors seriously endanger human health. At present, there is still no effective treatment for the vast majority of patients with advanced tumors in clinical practice. In addition to certain toxic side effects and drug resistance, conventional treatment also has the effect of killing tumor cells and causing The problem that normal tissues and cells are damaged, especially the damage to hematopoietic tissues and cells is particularly serious. Therefore, both medical staff and patients expect a new effective treatment method for tumo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/861C12N15/12C12N7/01A61K48/00A61K38/17A61P35/00
Inventor 钱程刘立姜威崔强蔡荣
Owner ZHEJIANG SCI-TECH UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More